ID: 976357572

View in Genome Browser
Species Human (GRCh38)
Location 4:84137131-84137153
Sequence GTGCAGAAGCAGAGGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976357572_976357579 20 Left 976357572 4:84137131-84137153 CCACCCTGCCTCTGCTTCTGCAC No data
Right 976357579 4:84137174-84137196 TAAAACCCAGAGGCTCATGCAGG No data
976357572_976357577 10 Left 976357572 4:84137131-84137153 CCACCCTGCCTCTGCTTCTGCAC No data
Right 976357577 4:84137164-84137186 GATACCTGAGTAAAACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976357572 Original CRISPR GTGCAGAAGCAGAGGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr