ID: 976357577

View in Genome Browser
Species Human (GRCh38)
Location 4:84137164-84137186
Sequence GATACCTGAGTAAAACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976357574_976357577 6 Left 976357574 4:84137135-84137157 CCTGCCTCTGCTTCTGCACCAGC No data
Right 976357577 4:84137164-84137186 GATACCTGAGTAAAACCCAGAGG No data
976357572_976357577 10 Left 976357572 4:84137131-84137153 CCACCCTGCCTCTGCTTCTGCAC No data
Right 976357577 4:84137164-84137186 GATACCTGAGTAAAACCCAGAGG No data
976357575_976357577 2 Left 976357575 4:84137139-84137161 CCTCTGCTTCTGCACCAGCTAAG No data
Right 976357577 4:84137164-84137186 GATACCTGAGTAAAACCCAGAGG No data
976357573_976357577 7 Left 976357573 4:84137134-84137156 CCCTGCCTCTGCTTCTGCACCAG No data
Right 976357577 4:84137164-84137186 GATACCTGAGTAAAACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976357577 Original CRISPR GATACCTGAGTAAAACCCAG AGG Intergenic
No off target data available for this crispr