ID: 976357579

View in Genome Browser
Species Human (GRCh38)
Location 4:84137174-84137196
Sequence TAAAACCCAGAGGCTCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976357574_976357579 16 Left 976357574 4:84137135-84137157 CCTGCCTCTGCTTCTGCACCAGC No data
Right 976357579 4:84137174-84137196 TAAAACCCAGAGGCTCATGCAGG No data
976357572_976357579 20 Left 976357572 4:84137131-84137153 CCACCCTGCCTCTGCTTCTGCAC No data
Right 976357579 4:84137174-84137196 TAAAACCCAGAGGCTCATGCAGG No data
976357575_976357579 12 Left 976357575 4:84137139-84137161 CCTCTGCTTCTGCACCAGCTAAG No data
Right 976357579 4:84137174-84137196 TAAAACCCAGAGGCTCATGCAGG No data
976357573_976357579 17 Left 976357573 4:84137134-84137156 CCCTGCCTCTGCTTCTGCACCAG No data
Right 976357579 4:84137174-84137196 TAAAACCCAGAGGCTCATGCAGG No data
976357576_976357579 -2 Left 976357576 4:84137153-84137175 CCAGCTAAGTTGATACCTGAGTA No data
Right 976357579 4:84137174-84137196 TAAAACCCAGAGGCTCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976357579 Original CRISPR TAAAACCCAGAGGCTCATGC AGG Intergenic
No off target data available for this crispr