ID: 976359017

View in Genome Browser
Species Human (GRCh38)
Location 4:84155611-84155633
Sequence GGACAAAAGCAGAGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976359017_976359024 1 Left 976359017 4:84155611-84155633 CCCTGCTTCCTCTGCTTTTGTCC No data
Right 976359024 4:84155635-84155657 TTAAGTGGCTAAATTGCAGGTGG No data
976359017_976359022 -2 Left 976359017 4:84155611-84155633 CCCTGCTTCCTCTGCTTTTGTCC No data
Right 976359022 4:84155632-84155654 CCCTTAAGTGGCTAAATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976359017 Original CRISPR GGACAAAAGCAGAGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr