ID: 976359789

View in Genome Browser
Species Human (GRCh38)
Location 4:84164214-84164236
Sequence TTGGCTGGCCGCAATACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976359789_976359793 25 Left 976359789 4:84164214-84164236 CCAGCTGTATTGCGGCCAGCCAA No data
Right 976359793 4:84164262-84164284 AAATCACTATACTTCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976359789 Original CRISPR TTGGCTGGCCGCAATACAGC TGG (reversed) Intergenic
No off target data available for this crispr