ID: 976360673

View in Genome Browser
Species Human (GRCh38)
Location 4:84174478-84174500
Sequence TTTTTTTTTTTTTTTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496384
Summary {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976360673_976360680 28 Left 976360673 4:84174478-84174500 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 976360680 4:84174529-84174551 AGGTCAAATGGAATCAAAGCAGG No data
976360673_976360679 16 Left 976360673 4:84174478-84174500 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 976360679 4:84174517-84174539 GTGTTGTTGCTAAGGTCAAATGG No data
976360673_976360675 8 Left 976360673 4:84174478-84174500 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 976360675 4:84174509-84174531 TGCCCCTAGTGTTGTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976360673 Original CRISPR TTTTTTTTTTTTTTTTGAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr