ID: 976360679

View in Genome Browser
Species Human (GRCh38)
Location 4:84174517-84174539
Sequence GTGTTGTTGCTAAGGTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976360673_976360679 16 Left 976360673 4:84174478-84174500 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 976360679 4:84174517-84174539 GTGTTGTTGCTAAGGTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976360679 Original CRISPR GTGTTGTTGCTAAGGTCAAA TGG Intergenic
No off target data available for this crispr