ID: 976364838

View in Genome Browser
Species Human (GRCh38)
Location 4:84221830-84221852
Sequence TGTGAAATGCAGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976364830_976364838 27 Left 976364830 4:84221780-84221802 CCTGCTCAGAATTAAATCCCTGC No data
Right 976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG No data
976364831_976364838 10 Left 976364831 4:84221797-84221819 CCCTGCAACATCAAGCTGAAAAG No data
Right 976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG No data
976364832_976364838 9 Left 976364832 4:84221798-84221820 CCTGCAACATCAAGCTGAAAAGG No data
Right 976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976364838 Original CRISPR TGTGAAATGCAGAGGGAAGT GGG Intergenic
No off target data available for this crispr