ID: 976366110

View in Genome Browser
Species Human (GRCh38)
Location 4:84234139-84234161
Sequence ATGGAGAATAAAAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976366107_976366110 -6 Left 976366107 4:84234122-84234144 CCTTCATCCTTCCAGCAATGGAG No data
Right 976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG No data
976366104_976366110 9 Left 976366104 4:84234107-84234129 CCCAGGTATAGATCTCCTTCATC No data
Right 976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG No data
976366105_976366110 8 Left 976366105 4:84234108-84234130 CCAGGTATAGATCTCCTTCATCC No data
Right 976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976366110 Original CRISPR ATGGAGAATAAAAATGATGA AGG Intergenic
No off target data available for this crispr