ID: 976366827

View in Genome Browser
Species Human (GRCh38)
Location 4:84241973-84241995
Sequence ATCTCTTGAGAATGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976366824_976366827 2 Left 976366824 4:84241948-84241970 CCTCAAAAGGGCTTACTGAATGG No data
Right 976366827 4:84241973-84241995 ATCTCTTGAGAATGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976366827 Original CRISPR ATCTCTTGAGAATGAAGCCC AGG Intergenic
No off target data available for this crispr