ID: 976367569

View in Genome Browser
Species Human (GRCh38)
Location 4:84247222-84247244
Sequence CTGCATCATCTTGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976367564_976367569 1 Left 976367564 4:84247198-84247220 CCCAGGTGTCAGCTCAAAGGATC No data
Right 976367569 4:84247222-84247244 CTGCATCATCTTGAGGTGGGAGG No data
976367561_976367569 24 Left 976367561 4:84247175-84247197 CCTGAGGGTAAGGGGATGACATG No data
Right 976367569 4:84247222-84247244 CTGCATCATCTTGAGGTGGGAGG No data
976367565_976367569 0 Left 976367565 4:84247199-84247221 CCAGGTGTCAGCTCAAAGGATCT No data
Right 976367569 4:84247222-84247244 CTGCATCATCTTGAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976367569 Original CRISPR CTGCATCATCTTGAGGTGGG AGG Intergenic
No off target data available for this crispr