ID: 976368221

View in Genome Browser
Species Human (GRCh38)
Location 4:84255190-84255212
Sequence CACTGCTGGTGCCTTAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976368215_976368221 23 Left 976368215 4:84255144-84255166 CCACAAATGACATTTGTACTGAG No data
Right 976368221 4:84255190-84255212 CACTGCTGGTGCCTTAATCAAGG No data
976368214_976368221 24 Left 976368214 4:84255143-84255165 CCCACAAATGACATTTGTACTGA No data
Right 976368221 4:84255190-84255212 CACTGCTGGTGCCTTAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976368221 Original CRISPR CACTGCTGGTGCCTTAATCA AGG Intergenic
No off target data available for this crispr