ID: 976373375

View in Genome Browser
Species Human (GRCh38)
Location 4:84315951-84315973
Sequence GGATGAACACACTCTGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976373372_976373375 19 Left 976373372 4:84315909-84315931 CCAACTCAGAGGCTGTTCAAAAA No data
Right 976373375 4:84315951-84315973 GGATGAACACACTCTGCCTCAGG No data
976373371_976373375 20 Left 976373371 4:84315908-84315930 CCCAACTCAGAGGCTGTTCAAAA No data
Right 976373375 4:84315951-84315973 GGATGAACACACTCTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976373375 Original CRISPR GGATGAACACACTCTGCCTC AGG Intergenic
No off target data available for this crispr