ID: 976380167

View in Genome Browser
Species Human (GRCh38)
Location 4:84389867-84389889
Sequence TCTTACTTCTGAACTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976380167_976380168 10 Left 976380167 4:84389867-84389889 CCTGGCTCAGTTCAGAAGTAAGA No data
Right 976380168 4:84389900-84389922 CATTAACAAGTAAGCATCACTGG No data
976380167_976380169 11 Left 976380167 4:84389867-84389889 CCTGGCTCAGTTCAGAAGTAAGA No data
Right 976380169 4:84389901-84389923 ATTAACAAGTAAGCATCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976380167 Original CRISPR TCTTACTTCTGAACTGAGCC AGG (reversed) Intergenic
No off target data available for this crispr