ID: 976380322

View in Genome Browser
Species Human (GRCh38)
Location 4:84391383-84391405
Sequence TGCCAGGTAGCGAAGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976380322_976380326 -9 Left 976380322 4:84391383-84391405 CCCCCATGCTTCGCTACCTGGCA No data
Right 976380326 4:84391397-84391419 TACCTGGCACTGCAGCCTACTGG No data
976380322_976380329 9 Left 976380322 4:84391383-84391405 CCCCCATGCTTCGCTACCTGGCA No data
Right 976380329 4:84391415-84391437 ACTGGTTCATGAGATTACACCGG No data
976380322_976380331 26 Left 976380322 4:84391383-84391405 CCCCCATGCTTCGCTACCTGGCA No data
Right 976380331 4:84391432-84391454 CACCGGGATGTGTTTATCCCAGG No data
976380322_976380330 10 Left 976380322 4:84391383-84391405 CCCCCATGCTTCGCTACCTGGCA No data
Right 976380330 4:84391416-84391438 CTGGTTCATGAGATTACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976380322 Original CRISPR TGCCAGGTAGCGAAGCATGG GGG (reversed) Intergenic
No off target data available for this crispr