ID: 976380330

View in Genome Browser
Species Human (GRCh38)
Location 4:84391416-84391438
Sequence CTGGTTCATGAGATTACACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976380325_976380330 7 Left 976380325 4:84391386-84391408 CCATGCTTCGCTACCTGGCACTG No data
Right 976380330 4:84391416-84391438 CTGGTTCATGAGATTACACCGGG No data
976380322_976380330 10 Left 976380322 4:84391383-84391405 CCCCCATGCTTCGCTACCTGGCA No data
Right 976380330 4:84391416-84391438 CTGGTTCATGAGATTACACCGGG No data
976380324_976380330 8 Left 976380324 4:84391385-84391407 CCCATGCTTCGCTACCTGGCACT No data
Right 976380330 4:84391416-84391438 CTGGTTCATGAGATTACACCGGG No data
976380323_976380330 9 Left 976380323 4:84391384-84391406 CCCCATGCTTCGCTACCTGGCAC No data
Right 976380330 4:84391416-84391438 CTGGTTCATGAGATTACACCGGG No data
976380327_976380330 -6 Left 976380327 4:84391399-84391421 CCTGGCACTGCAGCCTACTGGTT No data
Right 976380330 4:84391416-84391438 CTGGTTCATGAGATTACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976380330 Original CRISPR CTGGTTCATGAGATTACACC GGG Intergenic
No off target data available for this crispr