ID: 976380331

View in Genome Browser
Species Human (GRCh38)
Location 4:84391432-84391454
Sequence CACCGGGATGTGTTTATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976380322_976380331 26 Left 976380322 4:84391383-84391405 CCCCCATGCTTCGCTACCTGGCA No data
Right 976380331 4:84391432-84391454 CACCGGGATGTGTTTATCCCAGG No data
976380327_976380331 10 Left 976380327 4:84391399-84391421 CCTGGCACTGCAGCCTACTGGTT No data
Right 976380331 4:84391432-84391454 CACCGGGATGTGTTTATCCCAGG No data
976380325_976380331 23 Left 976380325 4:84391386-84391408 CCATGCTTCGCTACCTGGCACTG No data
Right 976380331 4:84391432-84391454 CACCGGGATGTGTTTATCCCAGG No data
976380328_976380331 -3 Left 976380328 4:84391412-84391434 CCTACTGGTTCATGAGATTACAC No data
Right 976380331 4:84391432-84391454 CACCGGGATGTGTTTATCCCAGG No data
976380323_976380331 25 Left 976380323 4:84391384-84391406 CCCCATGCTTCGCTACCTGGCAC No data
Right 976380331 4:84391432-84391454 CACCGGGATGTGTTTATCCCAGG No data
976380324_976380331 24 Left 976380324 4:84391385-84391407 CCCATGCTTCGCTACCTGGCACT No data
Right 976380331 4:84391432-84391454 CACCGGGATGTGTTTATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976380331 Original CRISPR CACCGGGATGTGTTTATCCC AGG Intergenic
No off target data available for this crispr