ID: 976380818

View in Genome Browser
Species Human (GRCh38)
Location 4:84396318-84396340
Sequence TTTTTAAACAGACTAAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976380817_976380818 -9 Left 976380817 4:84396304-84396326 CCTGTTTATTTTTTTTTTTAAAC No data
Right 976380818 4:84396318-84396340 TTTTTAAACAGACTAAAAGTTGG No data
976380816_976380818 -3 Left 976380816 4:84396298-84396320 CCATTTCCTGTTTATTTTTTTTT No data
Right 976380818 4:84396318-84396340 TTTTTAAACAGACTAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976380818 Original CRISPR TTTTTAAACAGACTAAAAGT TGG Intergenic
No off target data available for this crispr