ID: 976391719

View in Genome Browser
Species Human (GRCh38)
Location 4:84512398-84512420
Sequence CTGTGTGTACTGAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976391717_976391719 9 Left 976391717 4:84512366-84512388 CCGTGTGTCTGTGTGTCTGTATC No data
Right 976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG No data
976391716_976391719 23 Left 976391716 4:84512352-84512374 CCTGGCATGTGTGTCCGTGTGTC No data
Right 976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG No data
976391715_976391719 30 Left 976391715 4:84512345-84512367 CCTATCACCTGGCATGTGTGTCC No data
Right 976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976391719 Original CRISPR CTGTGTGTACTGAAGGAAGC AGG Intergenic
No off target data available for this crispr