ID: 976393065

View in Genome Browser
Species Human (GRCh38)
Location 4:84525685-84525707
Sequence CTGTATGTTTAGTTAAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123925
Summary {0: 1, 1: 0, 2: 84, 3: 5086, 4: 118754}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976393065_976393072 5 Left 976393065 4:84525685-84525707 CCCCGTCTTAACTAAACATACAG 0: 1
1: 0
2: 84
3: 5086
4: 118754
Right 976393072 4:84525713-84525735 AGATTAGCTGGGCATGGTGGCGG 0: 45
1: 8911
2: 27762
3: 53284
4: 59047
976393065_976393068 -7 Left 976393065 4:84525685-84525707 CCCCGTCTTAACTAAACATACAG 0: 1
1: 0
2: 84
3: 5086
4: 118754
Right 976393068 4:84525701-84525723 CATACAGAAAAAAGATTAGCTGG 0: 1
1: 0
2: 37
3: 1265
4: 3988
976393065_976393071 2 Left 976393065 4:84525685-84525707 CCCCGTCTTAACTAAACATACAG 0: 1
1: 0
2: 84
3: 5086
4: 118754
Right 976393071 4:84525710-84525732 AAAAGATTAGCTGGGCATGGTGG 0: 113
1: 13810
2: 70956
3: 145817
4: 202682
976393065_976393073 21 Left 976393065 4:84525685-84525707 CCCCGTCTTAACTAAACATACAG 0: 1
1: 0
2: 84
3: 5086
4: 118754
Right 976393073 4:84525729-84525751 GTGGCGGATGACTGTAATCCTGG 0: 1
1: 4
2: 279
3: 2774
4: 5830
976393065_976393070 -1 Left 976393065 4:84525685-84525707 CCCCGTCTTAACTAAACATACAG 0: 1
1: 0
2: 84
3: 5086
4: 118754
Right 976393070 4:84525707-84525729 GAAAAAAGATTAGCTGGGCATGG 0: 4
1: 116
2: 4228
3: 24533
4: 90718
976393065_976393069 -6 Left 976393065 4:84525685-84525707 CCCCGTCTTAACTAAACATACAG 0: 1
1: 0
2: 84
3: 5086
4: 118754
Right 976393069 4:84525702-84525724 ATACAGAAAAAAGATTAGCTGGG 0: 1
1: 14
2: 460
3: 2312
4: 12991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976393065 Original CRISPR CTGTATGTTTAGTTAAGACG GGG (reversed) Intergenic
Too many off-targets to display for this crispr