ID: 976398578

View in Genome Browser
Species Human (GRCh38)
Location 4:84583171-84583193
Sequence TGCAGCGAGCGCGGCTCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976398578_976398588 29 Left 976398578 4:84583171-84583193 CCGCCGGAGCCGCGCTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 162
Right 976398588 4:84583223-84583245 CGTTTTGGAGGTGACCGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 21
976398578_976398586 24 Left 976398578 4:84583171-84583193 CCGCCGGAGCCGCGCTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 162
Right 976398586 4:84583218-84583240 GATGCCGTTTTGGAGGTGACCGG 0: 1
1: 0
2: 0
3: 8
4: 95
976398578_976398585 17 Left 976398578 4:84583171-84583193 CCGCCGGAGCCGCGCTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 162
Right 976398585 4:84583211-84583233 TCTCGTTGATGCCGTTTTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 39
976398578_976398584 14 Left 976398578 4:84583171-84583193 CCGCCGGAGCCGCGCTCGCTGCA 0: 1
1: 0
2: 0
3: 5
4: 162
Right 976398584 4:84583208-84583230 CTCTCTCGTTGATGCCGTTTTGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976398578 Original CRISPR TGCAGCGAGCGCGGCTCCGG CGG (reversed) Exonic
900117326 1:1034200-1034222 TCCGGCCTGCGCGGCTCCGGGGG + Intronic
900337038 1:2169494-2169516 TGCAGGGAGAGAGGCGCCGGAGG - Intronic
901628954 1:10638957-10638979 TGCAGTGGGCGCGGGGCCGGGGG + Exonic
901660692 1:10796262-10796284 TGCCCGGCGCGCGGCTCCGGGGG - Intronic
902478817 1:16701253-16701275 TGCAGGGGGCGCGGAGCCGGCGG - Intergenic
904500035 1:30908308-30908330 GGCAGGGACCGCGGCCCCGGGGG + Intronic
907038294 1:51236207-51236229 GGAGGCGAGGGCGGCTCCGGCGG - Intergenic
912505006 1:110150399-110150421 GGCAGCGAGCGAGGCTCTGATGG - Intergenic
917207909 1:172597047-172597069 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
917275064 1:173322768-173322790 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
920379793 1:205528878-205528900 TGCAGGGATCGTGGCTCTGGCGG - Intronic
920631821 1:207659879-207659901 AGCAGCGAGCAAGGCTCCGTGGG - Intronic
923947122 1:238900498-238900520 AGCAGCGAGCAAGGCTCCGTGGG - Intergenic
924130376 1:240901053-240901075 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
1064354410 10:14604336-14604358 CGGCGCGAGGGCGGCTCCGGGGG + Intronic
1065101519 10:22336236-22336258 GGCAGCGCGCGCGGCTCCCTTGG + Intergenic
1065214779 10:23439175-23439197 TGCAGCGGGCGCGGCGCCCCGGG + Intergenic
1072287290 10:93928049-93928071 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1073927355 10:108532822-108532844 AGCAGCGAGCAAGGCTCCGTGGG - Intergenic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1077710480 11:4531785-4531807 AGCAGCGAGCAAGGCTCCGTAGG - Intergenic
1087589809 11:100173128-100173150 TGCAGCTAGCAAGGCTCTGGAGG - Intronic
1091903519 12:4164730-4164752 CGCAGGGCGCGCGGCTCCGCTGG - Intergenic
1093728704 12:22544203-22544225 TGCGCCGAGCGCGGGGCCGGCGG + Intronic
1094579267 12:31718957-31718979 AGCAGCGAGCAAGGCTCCGTGGG + Intronic
1096044900 12:48553961-48553983 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
1097758560 12:63434525-63434547 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
1098176031 12:67792398-67792420 AGCAGCGAGCAAGGCTCCGTAGG + Intergenic
1098521564 12:71439853-71439875 TGCAGCCAGGGCTGCTCCGAAGG + Exonic
1099806891 12:87531333-87531355 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
1100748646 12:97672928-97672950 AGCAGCGAGCATGGCTCCGTGGG - Intergenic
1101900675 12:108789151-108789173 TACAGCCAGCGGGGCTCCTGAGG - Exonic
1103203618 12:119110585-119110607 TGCAGTGAGTGAGGCTCCGTGGG + Intronic
1104403526 12:128497590-128497612 AGCAACGAGCGAGGCTCCGTGGG + Intronic
1108264902 13:48696891-48696913 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1110729241 13:78860664-78860686 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
1113201037 13:107867525-107867547 TGGAGCGAGCTCGGCGCGGGAGG - Intergenic
1113488098 13:110669941-110669963 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1113923540 13:113928174-113928196 TGCAGGGGCCGCGGCTCCTGGGG - Intergenic
1114579514 14:23744684-23744706 TGCAGTGAGCAAGGCTCCGTGGG + Intergenic
1115362296 14:32517576-32517598 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1116821948 14:49634824-49634846 AGCAGCCGGCCCGGCTCCGGTGG - Exonic
1119219389 14:72893681-72893703 GGCAGGGAGCGCGGCTTCGGGGG - Intronic
1119260877 14:73237546-73237568 TGCAGCCAGGGCCGCTCCGTCGG - Exonic
1124652550 15:31484271-31484293 GGCAGCGGGCGCGTCGCCGGCGG - Exonic
1125779503 15:42252013-42252035 TGCAGTGAGCAAGGCTCCGTGGG + Intronic
1127798206 15:62455947-62455969 TGCAGCCAGCCCTGCTCCTGGGG + Intronic
1130362965 15:83207695-83207717 AGCAGCGCGCGCGGCGGCGGCGG - Exonic
1132638505 16:966009-966031 AGCAGAGAGCAGGGCTCCGGTGG + Intronic
1133008338 16:2896822-2896844 TGGAGCCAGCGCGGCTGTGGGGG - Intronic
1136399791 16:30011062-30011084 TGCAGCCGGCGCGGCGGCGGGGG + Exonic
1138007319 16:53350149-53350171 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
1138357144 16:56391602-56391624 AGCAACGAGCGAGGCTCCGTGGG - Intronic
1141148304 16:81547305-81547327 TGCAGCGAGGGTGACTCTGGAGG + Intronic
1142240303 16:88941695-88941717 TGGAGGGGGCGCGGCTCTGGGGG + Intronic
1142488806 17:264266-264288 TCCAGCGCTCGCGGCTCCGAAGG - Intronic
1142488816 17:264329-264351 TCCAGCGCGCACGGCTCCGAAGG - Intronic
1142488826 17:264392-264414 TCCAGCGCGCACGGCTCCGAAGG - Intronic
1142488835 17:264455-264477 TCCAGCGCTCGCGGCTCCGAAGG - Intronic
1142488845 17:264518-264540 TCCAGCGCGCACGGCTCCGAAGG - Intronic
1142974868 17:3637155-3637177 TGCGGAGTGCGGGGCTCCGGGGG + Exonic
1143422751 17:6808226-6808248 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
1147123715 17:38351968-38351990 CGCGGCGGGCGGGGCTCCGGCGG + Intergenic
1150168378 17:62966269-62966291 TGCTGGGCGCGCTGCTCCGGCGG + Intergenic
1152192386 17:78896699-78896721 TGCTCCGAGCGCGGCTTCTGCGG - Intronic
1152714533 17:81892057-81892079 TCCGGCGGGCGCGGCTTCGGCGG + Intronic
1154364072 18:13690135-13690157 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1159001405 18:62978568-62978590 TGCTGCGAGCTCAGCGCCGGTGG + Exonic
1159099346 18:63940733-63940755 AGCAGCGAGCGAGCCTCCGTGGG - Intergenic
1160242290 18:77132576-77132598 AGCAACGAGCGCAGCGCCGGTGG - Exonic
1162778650 19:12995604-12995626 AGCGGCGAGCGCGGCGGCGGCGG + Exonic
1163013757 19:14441231-14441253 TGGAGCGGGAGCGGCTGCGGCGG + Exonic
1165026500 19:32966418-32966440 TGCAGCCAGCGTTGCTCCGAAGG - Exonic
1166106816 19:40601656-40601678 TCCCGAGAGAGCGGCTCCGGGGG + Intronic
1202712836 1_KI270714v1_random:27084-27106 TGCAGGGGGCGCGGAGCCGGCGG - Intergenic
926423189 2:12718100-12718122 TGCTCCGAGCCCGGCTCCCGGGG - Exonic
927302073 2:21526726-21526748 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
927786978 2:25981220-25981242 TGCAGCGAACGTGGCTCTGATGG - Exonic
928313810 2:30231397-30231419 TTCAGCGCTCGCAGCTCCGGCGG - Intergenic
928864969 2:35906651-35906673 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
929958338 2:46477736-46477758 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
930868182 2:56142896-56142918 AGCAGTGAGCGGGGCTCCGTGGG + Intergenic
931253787 2:60553885-60553907 CGCAGCGAGCGCCGCGGCGGTGG + Intergenic
931253853 2:60554151-60554173 GGGAGCGAGCGCGGCGGCGGCGG - Intergenic
931475819 2:62586607-62586629 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
933018507 2:77162202-77162224 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
939900609 2:147845213-147845235 TGCAGGGAGCGCGGCGCGGTGGG + Intronic
940257211 2:151743702-151743724 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
941517195 2:166494239-166494261 AGCAGCGGGCGCGGCTCCACTGG - Intronic
941987475 2:171522950-171522972 CGCCGCGAGCGCGGGGCCGGGGG + Intronic
942450912 2:176107617-176107639 AGCAGCGGGGGCGGCCCCGGCGG + Exonic
942753567 2:179314857-179314879 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
943262874 2:185688152-185688174 AGCAGCGAGCAAGGCTCCAGGGG + Intergenic
945667147 2:212757017-212757039 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
946719057 2:222584722-222584744 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
948669624 2:239559584-239559606 TGCAGCTGGCCCGGCTCCTGTGG + Intergenic
1173930187 20:46811483-46811505 ATCTGCGAGCGCGGCTCTGGTGG - Intergenic
1182197039 22:28529288-28529310 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1182435568 22:30327265-30327287 CGCAGGGAGCGGGGCTCAGGAGG - Intergenic
1183220209 22:36507194-36507216 TGCTGCGTTCGCTGCTCCGGGGG + Intergenic
949209199 3:1477849-1477871 AGCAACGAGCGAGGCTCCGTGGG - Intergenic
949456630 3:4246026-4246048 AGCAGCGAGCAAGGCTCCGTGGG + Intronic
954833741 3:53446508-53446530 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
955172620 3:56582173-56582195 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
956477401 3:69637112-69637134 AGCAGCGAGCAAGGCTCCGTAGG + Intergenic
959290706 3:104469608-104469630 AGCAGCGAGCAAGGCTCCGTGGG + Intergenic
960096622 3:113696293-113696315 GGCTGCGGGGGCGGCTCCGGAGG - Intronic
963528227 3:146440534-146440556 AGCAGCGAGCGAGGCTCCATGGG + Intronic
965973288 3:174589136-174589158 AGCAGCGAGCGAGGCTCCTTGGG + Intronic
968756500 4:2418759-2418781 GGCAGGGAGCGCGCCTCGGGCGG - Intergenic
968879561 4:3292310-3292332 AGCAGCGAGGGCGGGACCGGAGG - Intergenic
969436633 4:7192719-7192741 CGCGGCGAGCGCGGCGGCGGCGG - Exonic
969912260 4:10457379-10457401 TACAGCGGGCGCGGCGCCGGCGG - Intronic
971406013 4:26321176-26321198 TGCGCCGAGCGCGGCGGCGGCGG + Intronic
973626074 4:52773923-52773945 AGCAGCGAGCGAGGCTCCATGGG + Intergenic
975605249 4:76148308-76148330 TGCAGCCACCGCGGCCCCCGCGG - Exonic
976398578 4:84583171-84583193 TGCAGCGAGCGCGGCTCCGGCGG - Exonic
976751878 4:88457394-88457416 TCCACCGCGCGCTGCTCCGGAGG + Exonic
977653179 4:99492496-99492518 AGCAACGAGCGAGGCTCCGTGGG - Intergenic
978773318 4:112480330-112480352 AGCAACGAGCGAGGCTCCGTGGG + Intergenic
982579829 4:157163095-157163117 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
988843357 5:35104602-35104624 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
990541962 5:56782083-56782105 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
991634622 5:68691964-68691986 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
992031710 5:72727973-72727995 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
992873492 5:81029030-81029052 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
992950371 5:81852021-81852043 TGCAGGGAGCGCGGCAGCCGCGG - Intergenic
997137747 5:131344381-131344403 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
998193018 5:140042864-140042886 TGCTGCGGCCGCGGCTCTGGGGG + Exonic
998403698 5:141862042-141862064 TGCAGGGAGCGGGGCCCTGGGGG - Intronic
1001348836 5:170936054-170936076 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG + Exonic
1007424917 6:41740593-41740615 TGCAGCCAGCAGGGCTCCAGCGG - Exonic
1007860200 6:44900404-44900426 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1012933239 6:105338769-105338791 AGCAGCGAGCAAGGCTCCGTGGG - Intronic
1016523878 6:144977498-144977520 AGCAGCGAGCAAGGCTCCGTGGG + Intergenic
1019427194 7:983305-983327 GGCAGCGGGCGAGGCCCCGGGGG - Exonic
1021744259 7:23722845-23722867 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
1022619091 7:31964338-31964360 AGCAGTGAGCGAGGCTCCGTGGG - Intronic
1023951279 7:44848030-44848052 TGCTGCGAGAGCGGCGGCGGCGG - Exonic
1023955712 7:44885308-44885330 GGCAGCGAGCGCGGCGGCGGCGG - Exonic
1026987130 7:74561659-74561681 TGCAGTGAGTGTGGCTCCAGTGG + Intronic
1028985558 7:97006131-97006153 TGCTGCGAGTGCGGCTGCGGCGG - Exonic
1029606537 7:101602602-101602624 TGCAGCGAGGGCGGCCCTTGTGG - Intergenic
1032279750 7:130491309-130491331 TGCAGCGAGCGGGGCTGCGAGGG + Intronic
1034267984 7:149790378-149790400 AGCGACGAGCGCGGCTGCGGAGG + Intergenic
1044242412 8:89902569-89902591 TGCAGGGAGCCAGGCGCCGGAGG - Exonic
1047125443 8:121954766-121954788 AGCAGTGAGCGAGGCTCCGTGGG + Intergenic
1049471601 8:142777342-142777364 TGCGGTGAGCTCGGCTCGGGGGG - Intronic
1050597305 9:7216611-7216633 AGCAGCGAGCAAGGCTCCGTGGG - Intergenic
1052941508 9:34134789-34134811 CGCTGCTAGCGCGGGTCCGGCGG + Intergenic
1053582968 9:39425996-39426018 AGCAGCGAGCAAGGCTCCGTGGG - Intergenic
1054104547 9:60984739-60984761 AGCAGCGAGCAAGGCTCCGTGGG - Intergenic
1054581795 9:66922110-66922132 AGCAGCGAGCAAGGCTCCGTGGG + Intronic
1054889352 9:70234377-70234399 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
1058074623 9:100638060-100638082 AGCAGCGAGCAAGGCTCCGTGGG + Intergenic
1059455480 9:114397900-114397922 GGAAGCGCGCGCGGCTCCGAGGG + Intergenic
1060283556 9:122229076-122229098 TGAACCGAGCGGGGCTCCAGCGG - Intronic
1060700542 9:125746754-125746776 GGCTGGGTGCGCGGCTCCGGCGG + Intergenic
1061257407 9:129460641-129460663 CGCCGCGGGCCCGGCTCCGGGGG + Intergenic
1061955735 9:133960412-133960434 TGCAGGGAGTGAGGCTCCAGTGG - Intronic
1062578694 9:137220381-137220403 AGCAGCGAGCGAGGCTCAGCGGG + Exonic
1203781098 EBV:101257-101279 TGCAGGGAATGCGGCCCCGGCGG + Intergenic
1203377183 Un_KI270442v1:385308-385330 TGCAGAGATCGCGACCCCGGAGG - Intergenic
1187374518 X:18739894-18739916 AGCAGTGAGCGAGGCTCCGTGGG + Intronic
1197477995 X:126947136-126947158 AGCAGTGAGCGAGGCTCCGTGGG - Intergenic
1198567220 X:137916738-137916760 TGCAGTGAGGGCAGCTCTGGTGG + Intergenic
1198572354 X:137971323-137971345 AGCAGCGAGCAAGGCTCCGTGGG - Intergenic