ID: 976399924

View in Genome Browser
Species Human (GRCh38)
Location 4:84596059-84596081
Sequence CTCTATCCCCAAATGGAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976399924_976399927 23 Left 976399924 4:84596059-84596081 CCCGATTCCATTTGGGGATAGAG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 976399927 4:84596105-84596127 GCACATACTCACCAAGCTCCTGG No data
976399924_976399928 30 Left 976399924 4:84596059-84596081 CCCGATTCCATTTGGGGATAGAG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 976399928 4:84596112-84596134 CTCACCAAGCTCCTGGTTGCAGG 0: 1
1: 0
2: 1
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976399924 Original CRISPR CTCTATCCCCAAATGGAATC GGG (reversed) Intronic
901380822 1:8872791-8872813 TTCTATGCCCAACTGGAAACTGG + Intronic
902274020 1:15326320-15326342 CTCTAACTACTAATGGAATCAGG + Intronic
905030572 1:34880923-34880945 TCCTATCCCCAAAAGGCATCAGG + Intronic
906110327 1:43318149-43318171 CTCAATCCCCAGATACAATCAGG - Intronic
907018156 1:51037462-51037484 CTCTAGCTGCAAAAGGAATCTGG - Intergenic
907848589 1:58232432-58232454 CACTATCCCCAAATGTGGTCAGG + Intronic
908087540 1:60652373-60652395 CTCTATCTCCAAATACAGTCAGG + Intergenic
908834568 1:68215931-68215953 CTCTTTCCCCGGGTGGAATCTGG - Intronic
910490309 1:87762606-87762628 TTCTATCAAAAAATGGAATCTGG + Intergenic
923136108 1:231120909-231120931 CTCTAGCCCCCAAAAGAATCAGG + Intergenic
924320746 1:242846656-242846678 TTCTATGCCCAAAAGGAATGAGG + Intergenic
1067618934 10:47776553-47776575 CTCTATTCCCCAAGGGAATGTGG - Intergenic
1071117577 10:82240521-82240543 CTTTTTCCCCTAATGGAATTAGG - Intronic
1072573798 10:96681286-96681308 CTCTATCTCCAAATCCAGTCGGG + Intronic
1072797348 10:98366062-98366084 CTTTATCCCCAAATGAAAAGGGG + Intergenic
1074289356 10:112126863-112126885 CTCTGTGCCCAGATGGACTCGGG - Intergenic
1074736031 10:116433944-116433966 CTCTATCACTAAGTGGAATTGGG - Intronic
1074946693 10:118286810-118286832 CGCTTTTCCAAAATGGAATCAGG + Intergenic
1077510128 11:2955231-2955253 CTCTGTCGCCCAATGGAATACGG + Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1089255259 11:117190608-117190630 CTCTCTCCCCAACAGGAATGTGG + Exonic
1089598792 11:119600221-119600243 CTCTAGACCCAAATGGGAGCAGG - Intergenic
1091831778 12:3555158-3555180 CCCTACCCCTAAATGGAATGTGG - Intronic
1095801400 12:46272935-46272957 CTGCAGCCTCAAATGGAATCAGG + Intergenic
1096872537 12:54602497-54602519 CTCTGTACCCAAGTGGAATTGGG - Intergenic
1100964776 12:100000510-100000532 CTCTCTACCCAAATGCACTCAGG - Intergenic
1101075735 12:101127733-101127755 TTGTAACCCCAAATGGAGTCAGG - Intronic
1101574252 12:105982921-105982943 GTCTTTCCCCAAAGGGTATCAGG - Intergenic
1102060690 12:109928660-109928682 CTCTACTCCCAAATGGAAGAAGG - Intronic
1107630123 13:42334432-42334454 CTCCATCCCCACTCGGAATCGGG + Intergenic
1108746814 13:53404496-53404518 CTGTATCCCCAAAAGGCATGGGG + Intergenic
1108864257 13:54903474-54903496 ATCTATCTCCAAATGGATACAGG - Intergenic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1116493098 14:45528790-45528812 CAGTCTCCCAAAATGGAATCAGG + Intergenic
1118438306 14:65790954-65790976 CTCTAACCCCAGAAGAAATCAGG - Intergenic
1118669208 14:68103667-68103689 GTCTATCCTCTAATGAAATCTGG - Intronic
1118677103 14:68198896-68198918 AACTGTCCCCAAATGGAATAGGG - Intronic
1125387618 15:39155034-39155056 CTTTATTCCCAAAAGGATTCAGG + Intergenic
1132234183 15:100206730-100206752 AGATATCCCCAAAGGGAATCTGG + Intronic
1140911659 16:79459267-79459289 ATATATGCCAAAATGGAATCAGG - Intergenic
1141428936 16:83960919-83960941 CTCTAGCCCCAAATGGGTTCAGG + Intronic
1144397833 17:14862426-14862448 TTCTATCCACAAATGGTCTCTGG - Intergenic
1144437843 17:15257447-15257469 CGCCATCCCCAAGTGGCATCTGG - Intronic
1146063740 17:29620256-29620278 TACTATCCCCAAATGGGAGCTGG + Intronic
1147425391 17:40343708-40343730 CCCTATCCCCAAGTGAAGTCAGG - Intronic
1148523298 17:48302842-48302864 CTCTATCCCTCACTGGATTCTGG - Intronic
1150649845 17:67002644-67002666 CTCCATCCTCAAATAGAATAGGG + Intronic
1151401111 17:73856753-73856775 CTCTCTCCACAGATGTAATCAGG + Intergenic
1155689103 18:28595019-28595041 CTCCTTCCATAAATGGAATCAGG + Intergenic
1162958616 19:14113429-14113451 CTATGAACCCAAATGGAATCTGG - Intronic
1166158427 19:40933248-40933270 CTCTGGCTCCAAAAGGAATCTGG - Intergenic
926143190 2:10380730-10380752 CTCCAGCCCCACCTGGAATCTGG - Intronic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
933014172 2:77103140-77103162 CTCTGCCCCCAAATGAAACCTGG - Intronic
935065934 2:99647796-99647818 CTTTATCCTCAAATGTAATAGGG - Intronic
935957898 2:108396962-108396984 GTCTCTCCCCAAAGGGAGTCTGG + Intergenic
937477750 2:122230003-122230025 CTCTCTCTCCCAATGCAATCTGG - Intergenic
939775600 2:146383861-146383883 CAAAATCCCCAAATGGGATCTGG + Intergenic
944682544 2:202090517-202090539 CTCTATCTCAAGATGGGATCTGG + Intronic
945072462 2:206005117-206005139 CTCTCTCCCCAAGTGCACTCTGG + Exonic
946363669 2:219235331-219235353 CTCTATACCCAAAATGACTCAGG - Intronic
947363161 2:229366728-229366750 ATCTATCCCCAAATACAATGTGG + Intronic
1168845475 20:941485-941507 CTCTCTCTCCAAGTGGAAGCTGG + Intergenic
1178356142 21:31912058-31912080 GTCTACCCCAAATTGGAATCTGG + Intronic
1183105095 22:35609933-35609955 CTATATTCCCAACTGGAAGCAGG - Intronic
949815390 3:8052855-8052877 CTCTAACCTCAGAAGGAATCTGG - Intergenic
953552010 3:43910347-43910369 CTCTTTCCCCATATGTAATCTGG - Intergenic
954700086 3:52446379-52446401 CTCAATCCTGAAATGGAAACAGG + Intergenic
957472119 3:80671232-80671254 CTTTATCCCCACATGTAAGCTGG - Intergenic
958653623 3:96973088-96973110 TTCTATACCCAAAAGGAATCTGG + Intronic
958866103 3:99503507-99503529 CCTGATCCCCAAAGGGAATCTGG + Intergenic
959749124 3:109812377-109812399 CTCTATCTTCAAATTAAATCTGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960188002 3:114667922-114667944 CTCAATCCTCAAATGGAAATGGG + Intronic
962480620 3:135795104-135795126 CTTTATCACCAAATGGATACAGG + Intergenic
963460547 3:145608495-145608517 CTCCATCCCCAAGTAGGATCTGG - Intergenic
964743872 3:159993623-159993645 CTCTTTCCTCAAATGCAATGGGG + Intronic
965188430 3:165497345-165497367 ATATTTCCCCAAGTGGAATCTGG - Intergenic
967616466 3:191574454-191574476 TTCTTTCCCCAAATGGAATGAGG - Intergenic
969016921 4:4109299-4109321 CTCAATCCCCAAAGGCAATGTGG + Intergenic
969497285 4:7533407-7533429 CTCTATTGCCAGCTGGAATCTGG - Intronic
971551901 4:27967909-27967931 CTCTAGCCACAAAGGGAAGCTGG + Intergenic
976399924 4:84596059-84596081 CTCTATCCCCAAATGGAATCGGG - Intronic
980237486 4:130128272-130128294 CTCTACCTCCAAATGCTATCAGG - Intergenic
981649982 4:147046479-147046501 CTCTTTCCCCAAATGTTAACTGG + Intergenic
982292079 4:153790724-153790746 CTCTTTCCCCAAATTGGTTCAGG + Intergenic
984548306 4:181132491-181132513 CTGTATCCCCAAGTGGGGTCCGG + Intergenic
987586539 5:19863651-19863673 CTCTATCCACCAATGCAACCTGG + Intronic
990215841 5:53530908-53530930 CTTCATCCCCAAATGGAGGCAGG - Intergenic
990390557 5:55315561-55315583 CTCTATGCCGCAATGGAATATGG - Intronic
998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG + Intronic
1001022572 5:168195932-168195954 CTCTATGCCCAAATGGATTAAGG - Intronic
1001649310 5:173304130-173304152 CCCCACCCCCAGATGGAATCAGG - Intergenic
1002195828 5:177500783-177500805 CTCCCTCCACACATGGAATCTGG - Intergenic
1002887436 6:1310129-1310151 CCCTTGCCCCAAATGAAATCAGG + Intergenic
1014143003 6:117965549-117965571 CTCCCTCCCCAAAAGGATTCTGG + Intronic
1016598980 6:145835018-145835040 GTCTCTCCCCAAATGAAATCTGG + Intergenic
1018667048 6:166148415-166148437 ATCTACCCTCAAATGGAAACAGG - Intergenic
1018792333 6:167157996-167158018 CTCTTTCCCCAAATGAATTTTGG - Exonic
1018955040 6:168403844-168403866 CTCCATCCTCAAATGGAAGGGGG - Intergenic
1020409263 7:7872986-7873008 ATCTAAACCCAAATGGGATCTGG + Intronic
1024776166 7:52789053-52789075 CACTATCCCCAGAAGCAATCAGG + Intergenic
1027770214 7:82397152-82397174 CGCTTTCCCCAAAAGGATTCTGG + Intronic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037649756 8:20825603-20825625 TTCTATCCCCTAATGGCTTCAGG + Intergenic
1039326852 8:36495080-36495102 CTAGATCCCTGAATGGAATCTGG + Intergenic
1039866370 8:41507297-41507319 CTCTATCACCAAATAGAACTTGG - Intronic
1043261958 8:78212095-78212117 TTCTATCCCCAAATGAAATGTGG - Intergenic
1045726088 8:105175293-105175315 CTAATTCCCCAAATGGAATGGGG - Intronic
1046463831 8:114576349-114576371 CTCTTTTCCAAAATGGAATCAGG - Intergenic
1047749638 8:127870509-127870531 CTCAATCCCCAAAGGGTATTTGG - Intergenic
1057406894 9:94780367-94780389 CTCTGTCCTCAACTGGAATTTGG - Intronic
1059185131 9:112261373-112261395 CTCTATCGCCAATTGGTATAAGG + Intronic
1192441110 X:71174534-71174556 CTCAGTCCCCACATGGATTCAGG + Intergenic
1194525918 X:94977617-94977639 CTCCATGCCCACATGGAAGCTGG - Intergenic
1197661849 X:129181897-129181919 CTTTATCACTAAAAGGAATCAGG + Intergenic
1198422677 X:136483110-136483132 CCCTATCCCTCAATGGCATCTGG + Intergenic
1200216196 X:154369242-154369264 CACTCTCCCCAAATGGCAGCAGG + Intronic