ID: 976400681

View in Genome Browser
Species Human (GRCh38)
Location 4:84603321-84603343
Sequence CTGGAGTGAGGGTGTTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976400681_976400687 7 Left 976400681 4:84603321-84603343 CCAGTTCAACACCCTCACTCCAG 0: 1
1: 0
2: 2
3: 7
4: 202
Right 976400687 4:84603351-84603373 CTCTGTAAGCCATTCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976400681 Original CRISPR CTGGAGTGAGGGTGTTGAAC TGG (reversed) Intronic
901039691 1:6356445-6356467 CTGGGCTGAGGGTGCTGAGCGGG - Intronic
901110570 1:6790275-6790297 CAGGAGTGGGGGTGGTGAAGAGG + Intronic
901485372 1:9556511-9556533 CTGGACTGGGGATGCTGAACTGG - Intronic
902152229 1:14452669-14452691 CAGGAGTGAGGCTGTTGCGCTGG - Intergenic
902772160 1:18651762-18651784 CTGGAGGGAGGGTGTTGGGGAGG - Intronic
903172122 1:21560848-21560870 CTGGAGGAAGGGTGTTTAAAAGG + Intronic
903308904 1:22436977-22436999 GGGGAGGGAGAGTGTTGAACTGG + Intergenic
904418733 1:30378122-30378144 CTGGATTAAGGGGGTTGAGCTGG - Intergenic
904888579 1:33760890-33760912 CTGGATTGAGGGTGTGGTAAGGG - Intronic
907510435 1:54954137-54954159 CTTGAGTGACTGTGTGGAACAGG - Intergenic
913511615 1:119567774-119567796 CTAGAGTCAGGGTGTTGGAGTGG - Intergenic
913515850 1:119605101-119605123 CTAGAGTCAGGGTGTTGGAGTGG - Intergenic
914678620 1:149923421-149923443 ATGGAGTGGGGGTGCTGAAAGGG + Exonic
914682707 1:149950504-149950526 ATGGAGAGAGGCTATTGAACAGG - Intronic
915647800 1:157286276-157286298 CGGGAGTGAGGGTGAGGAACAGG + Intergenic
916520408 1:165558283-165558305 CTGGAGTGAGGCTGAGGAAAGGG + Intronic
918533579 1:185550045-185550067 CTGGAGTGAGGGGGCTGCAGGGG - Intergenic
919507719 1:198420797-198420819 CTGGAGATAGGGTGGAGAACAGG + Intergenic
920710738 1:208292453-208292475 CTGCAGTCAAGGTGTTGACCAGG - Intergenic
921172816 1:212564366-212564388 GAGGAGTGGGGGTGATGAACAGG + Intergenic
921265179 1:213416076-213416098 CCGGGGTGAGGGTGTTGAGGTGG + Intergenic
922139141 1:222864137-222864159 CTGGAGTGCTGGATTTGAACTGG - Intergenic
922169385 1:223142476-223142498 CAGGAGTGAGGGTGCTGCCCTGG - Intronic
923630140 1:235644391-235644413 CTGGAGTGTGGGTGTGGAGGTGG - Intronic
924145932 1:241074689-241074711 CTGGAGTGAGGGTGAGGAGGAGG - Intronic
924561337 1:245158070-245158092 GTGCTGTGAGGTTGTTGAACTGG + Intronic
1063242463 10:4185265-4185287 CTGGTGGGAGGGAGCTGAACAGG + Intergenic
1064592846 10:16912604-16912626 GTGAAGTGAGGGTGTGGAGCAGG + Intronic
1064810816 10:19196121-19196143 CAGGAGTAATGCTGTTGAACAGG - Intronic
1067009802 10:42700436-42700458 ATGAAGTGAGGGTGTGGAGCAGG + Intergenic
1067313921 10:45142864-45142886 ATGAAGTGAGGGTGTGGAGCGGG - Intergenic
1067527485 10:47047286-47047308 CTGGAGTGTGGGTGGTGTGCGGG + Intergenic
1067782258 10:49217219-49217241 CTGGAGTGGGGGTGGGGGACCGG - Intergenic
1068313018 10:55303523-55303545 GAGGAATGAGGGTTTTGAACTGG + Intronic
1071345859 10:84691939-84691961 TTGGAGTGAGGCTCTTGAAGAGG + Intergenic
1072705438 10:97677479-97677501 ATGGTGTGGGGGTGTGGAACAGG + Exonic
1076916153 10:133423944-133423966 CTGGATTGGGGGTGTAGAAGCGG + Intronic
1076936261 10:133568739-133568761 CTGGATTGGGGGTGTAGAAGCGG + Intronic
1077496146 11:2887247-2887269 CTGAAGTGAGGGGGGTGAACTGG + Intergenic
1078646813 11:13148227-13148249 CTGGAGTGAGGGGGTCAAAGCGG + Intergenic
1078669449 11:13352041-13352063 CTGGGGTGAGGGTTCTGAAATGG + Intronic
1080430358 11:32192378-32192400 CTGAGGTCAGGGTGTTGACCAGG - Intergenic
1081754150 11:45532695-45532717 TTGGAGTGTGGGTGTCGAGCTGG - Intergenic
1085136600 11:74095260-74095282 CTGGATTGAGAGTGTTGAACTGG + Exonic
1092603769 12:10096785-10096807 CGGGAGTGAGGGTGTTTGAGAGG - Intronic
1093241562 12:16683070-16683092 CTAGAGTGATGGTGTTGAGTAGG - Intergenic
1098592965 12:72235898-72235920 CTGGAGTGAGGGAGTACAAATGG + Intronic
1099050947 12:77781114-77781136 CTGCAATGAAGGTGTTGACCAGG + Intergenic
1101937788 12:109072236-109072258 GTGGGGTGAGGGTGGTGAAAGGG + Intronic
1102007660 12:109598693-109598715 CTGGAGCAAGAGTGTTGAGCTGG - Intergenic
1103341840 12:120224960-120224982 CTGGAGTGAGGCTGGTGCAGCGG + Intronic
1110528817 13:76572374-76572396 CTGGAGTCAGGCTGTTGACATGG + Intergenic
1111186396 13:84741888-84741910 GTGGAGTGAGGGGATTGAAATGG - Intergenic
1113049180 13:106189545-106189567 TTGGAGTGAATGTGATGAACAGG + Intergenic
1116628947 14:47304569-47304591 CTGGAGGTAGGATGATGAACTGG - Intronic
1118175264 14:63433430-63433452 CTGGAGGGAGGGGCATGAACAGG - Intronic
1120827501 14:88969026-88969048 CAGGAGGGAGGGTGGTGAGCTGG - Intergenic
1121901981 14:97701599-97701621 CTGGGGTGAGGGTGGAGAAATGG + Intergenic
1122020361 14:98833250-98833272 CTGGAGTGTGGGAGTGGAAGGGG - Intergenic
1122032147 14:98920031-98920053 CTGGATTGATGGTGCTGAAATGG + Intergenic
1129521284 15:76187820-76187842 CTGAAGCCAGGGAGTTGAACAGG + Intronic
1129945234 15:79533929-79533951 CTGGTATGAGGGTGTTCCACTGG + Intergenic
1131723649 15:95199984-95200006 CAGGAGTGAGGTTGTTGGAGAGG + Intergenic
1132673905 16:1113911-1113933 GTGGAGTGAGGGTGGTGAGTGGG - Intergenic
1132673926 16:1113980-1114002 GTGGAGTGAGGGTGGTGAGTGGG - Intergenic
1132673963 16:1114092-1114114 GTGGAGTGAGGGTGGTGAGTGGG - Intergenic
1133972558 16:10578407-10578429 CTGGGGTGAGGGTGGAGAAGCGG + Intronic
1136252245 16:29012950-29012972 CTGGAGTGACAGAGATGAACAGG - Intergenic
1136675067 16:31895673-31895695 CTGGAGTGAGGGGGTCCCACTGG + Intronic
1137712156 16:50573869-50573891 CGGGGGTGAGGGTGCTGAGCTGG + Intronic
1141148920 16:81551015-81551037 CTGGGGTGCGTGTGATGAACTGG - Intronic
1146478394 17:33181659-33181681 CTGGATTGAGGGTGATGCCCAGG - Intronic
1147329513 17:39688760-39688782 CTGGAGGTAGAGTGGTGAACAGG - Intronic
1147556799 17:41484772-41484794 CTGGCTTCAGAGTGTTGAACAGG - Intergenic
1147626818 17:41905752-41905774 CTGGAGTTAGCCTGTGGAACCGG + Intronic
1148060545 17:44833009-44833031 CTGGAATGAGGGTCTTCAAGGGG - Intergenic
1148473212 17:47908897-47908919 CTGGAGTCAGGATGTTGAGATGG - Intronic
1148638822 17:49169650-49169672 CCCGGGTGAGGGTGTTGGACCGG - Exonic
1151179445 17:72315968-72315990 CTGGAGGGAAGGAGTTGAACAGG - Intergenic
1152162037 17:78674916-78674938 CTGGAGTGAGGGGGGTGGCCGGG - Exonic
1154171690 18:12057086-12057108 CTGGAGCGGGGGTGCTGCACAGG - Intergenic
1155373604 18:25132135-25132157 CTTGAGTGATGGTGTGAAACGGG + Intronic
1156002753 18:32403519-32403541 CTTGAGTTAGGGTGAGGAACTGG - Intronic
1156422283 18:36967793-36967815 GTGGAGTGGGTGAGTTGAACAGG + Intronic
1160048357 18:75408383-75408405 CTGGAGGGTAGGTGTTGATCAGG - Intronic
1160724491 19:611701-611723 CTGGAGTGAGGCTGTGGTATCGG - Intronic
1162312751 19:9916817-9916839 CTGGCATGAGGGTGTGGACCTGG - Intronic
1162635378 19:11963834-11963856 CTGGAGAGAGGGTGGAGAGCTGG - Intronic
1163639232 19:18451963-18451985 CTGCAGTGAGCGTTCTGAACAGG - Intronic
1165038141 19:33049457-33049479 CTGGAGTGAGGGTTTGCACCAGG + Intronic
1165855573 19:38877869-38877891 CTGGAGAGAGGGTGATGAACAGG + Intronic
1166201326 19:41239507-41239529 AGGGAGTGAGGGTGTGGCACGGG - Intronic
1166201333 19:41239532-41239554 AGGGAGTGAGGGTGTGGCACGGG - Intronic
1168722968 19:58564567-58564589 CTGCAGTCAGGGTGTGGAAATGG - Intronic
925350079 2:3194884-3194906 CTGGAGCGAGTGGGTTGCACTGG - Intronic
925463921 2:4089342-4089364 CTGGAGAGAGGGGGATGAAGAGG + Intergenic
926786799 2:16525875-16525897 CTGGACTGAGGCTGATGATCAGG - Intergenic
927968981 2:27292144-27292166 CAGGTGGGAGGGTGTTGAAGAGG + Intronic
927997128 2:27494470-27494492 CGGGAGCCAGGGTGTTTAACAGG + Intronic
929598702 2:43191766-43191788 CGGAAGTGAGGGTGATGATCAGG - Intergenic
930021387 2:47004091-47004113 CTGGAGTCAGCCTGTGGAACAGG - Intronic
931744817 2:65282686-65282708 CTGGAGTGGGAGTGTCTAACGGG - Intergenic
931979795 2:67682453-67682475 CTGGAGAGATGGTGCTGAATAGG - Intergenic
932756645 2:74414443-74414465 CTGGTGTGAGCATGTGGAACCGG - Exonic
934127613 2:88913706-88913728 CTGCAGTCAAGGTGTTGACCAGG - Intergenic
934619304 2:95794222-95794244 CTGGAGAGCGGGTGTTGGCCGGG + Intergenic
934641588 2:96030335-96030357 CTGGAGAGCGGGTGTTGGCCGGG - Intronic
938382863 2:130846468-130846490 CTGGAGTGAGGGCGCTGGCCTGG - Intronic
940748760 2:157599467-157599489 CTAGAGTGAGCTTGTTGAGCCGG - Intronic
941323837 2:164088264-164088286 CTGCAGTGAGGGTATTTTACAGG + Intergenic
942045614 2:172097618-172097640 CTGGGGTGCGGGTGGTGGACAGG + Intergenic
942319164 2:174721183-174721205 CTGGAGTGGGGGTGTGGGAGAGG - Intergenic
942910708 2:181241036-181241058 CTGGAGGGAGTATATTGAACAGG + Intergenic
944998012 2:205316386-205316408 CTGGAATGAGGTTTCTGAACAGG + Intronic
945911508 2:215655212-215655234 CTGGAATGAGGGTCTTTAAGGGG + Intergenic
948995988 2:241579045-241579067 GTGGGGGGATGGTGTTGAACGGG + Intergenic
1168956266 20:1836559-1836581 CTGGAGTGAGGATGTACTACAGG - Intergenic
1169560337 20:6793024-6793046 CTGAAATGAAGGTGTTGACCAGG - Intergenic
1171849069 20:30295350-30295372 CTGGTTTTAGGGTGTTGACCTGG - Intergenic
1173000510 20:39102136-39102158 CTGGAGTCTGGCTGTTGAGCAGG - Intergenic
1175179616 20:57136220-57136242 CTGGAGTTAGGGTTTAGAAAAGG + Intergenic
1175424874 20:58856912-58856934 CTGGGGGGAGGGTGGGGAACTGG - Intronic
1176277223 20:64279245-64279267 CTGGAATGAGGGTGTTGGCAGGG + Intronic
1176995303 21:15548528-15548550 ATGGAGGGAGGGTGGTAAACAGG + Intergenic
1177420678 21:20852969-20852991 CTGAAGTCAGGGTGTTGATAAGG + Intergenic
1179823916 21:43953154-43953176 CTGGCCTGATGGTGTTGAAGCGG - Intronic
1181530686 22:23515571-23515593 CTCCAGAGAGGGCGTTGAACAGG - Intergenic
1181546344 22:23604613-23604635 CTGGACTGCTGGTGTTGCACAGG + Intergenic
1182004147 22:26944992-26945014 CTGGAGTGGGGGTGGTCAACTGG + Intergenic
1183589343 22:38770707-38770729 ATGGAGACAGGGTGCTGAACAGG - Intronic
1184469427 22:44687713-44687735 GTGGAGAGAGGGTGTTGAGACGG - Intronic
1185237808 22:49724924-49724946 CTGGTGTGAGGCTGTGGGACCGG - Intergenic
949159144 3:859521-859543 CTAGTGTGAGGGTGTGGATCTGG - Intergenic
950433094 3:12962541-12962563 CAGGTGTGTGGGTGCTGAACTGG - Intronic
950934442 3:16824345-16824367 CTGGAGTGAGGGTGGGGAGACGG - Intronic
951588324 3:24237452-24237474 CTAGAATGAGATTGTTGAACTGG - Intronic
951615597 3:24540087-24540109 CTGGATTGCTGGTGTTCAACGGG + Intergenic
953926303 3:46984392-46984414 CTGGAGAGGGGGTGCTGAAAGGG - Intronic
955017106 3:55081801-55081823 TTGGAGTAGGGATGTTGAACTGG + Intergenic
961425168 3:126839615-126839637 GTGGGGTGAGGGGGTTCAACAGG - Intronic
961679792 3:128591754-128591776 CTGGTGTGTGGGTTTTGAAAAGG - Intergenic
963401935 3:144808868-144808890 CTTGAGTTAGGGTGCTCAACAGG + Intergenic
965832866 3:172814928-172814950 CTGGAGTGAGATTGGTCAACAGG - Intronic
967804741 3:193705329-193705351 CAGGAGTGTGGGGGATGAACAGG - Intergenic
968885588 4:3329410-3329432 CTTGAGAGAGTGTGTTGCACAGG + Intronic
970351180 4:15203104-15203126 CTGGATTTGGGGTGTGGAACAGG - Intergenic
970388774 4:15585503-15585525 ATGGAGAGAGGCTGTTCAACAGG + Intronic
972495149 4:39627659-39627681 CTGGAGTGTGTGTGTTCCACTGG + Intronic
973167442 4:47094902-47094924 CTTGAGTGGGCCTGTTGAACTGG + Intronic
974850836 4:67403532-67403554 CTGCAGTGAGGGGGTTATACAGG + Intergenic
975530871 4:75397840-75397862 GTGGAGGGAGTGTGTGGAACAGG - Intergenic
976400681 4:84603321-84603343 CTGGAGTGAGGGTGTTGAACTGG - Intronic
977870010 4:102080389-102080411 CTGCAATCAGGGTGTTGACCAGG + Intergenic
977884333 4:102239449-102239471 CTGGAATGAGGCTTCTGAACTGG - Intergenic
977894235 4:102345655-102345677 CAGGAGTGAGGGTGGGGAAGAGG - Intronic
978768748 4:112432023-112432045 CTGGAGTCAGGATTTTGAACAGG - Exonic
981230035 4:142341948-142341970 CTATAGTCAAGGTGTTGAACGGG - Intronic
982703871 4:158686582-158686604 CTGGAGTGAGAGTTTTCAAGGGG + Intronic
983965583 4:173806038-173806060 CTGTAGTGAGGATATTGAGCAGG + Intergenic
985543831 5:499470-499492 CTGGAATGAGTCTGTGGAACAGG - Intronic
991579314 5:68137665-68137687 CTGGAGGGACAGTCTTGAACTGG + Intergenic
997449667 5:133971664-133971686 CTGGAATTAGGGTGTCGACCAGG - Intergenic
999717101 5:154370156-154370178 TTGAAGTGAAGGTGTTGAACTGG + Intronic
999914919 5:156248017-156248039 ATGGAGTGACAGTGTTGAAAAGG + Intronic
1000045137 5:157516192-157516214 CTGGGGTGGGGGTGTGTAACAGG - Intronic
1002101520 5:176860358-176860380 CTGGAGTGGGGGTGTGGGATGGG - Intronic
1002279557 5:178122451-178122473 CGGGATTGAGGCTGTTGACCTGG + Exonic
1003950954 6:11115328-11115350 CTGCAGTCAGGGTGTTGGCCTGG + Intronic
1006767291 6:36519020-36519042 CAGGGGAGAGGGTGTTGAAATGG - Intronic
1007163235 6:39809866-39809888 CTGGAGTGTGTCTGCTGAACTGG - Intronic
1007226170 6:40316382-40316404 CTGGAGTTGGGGTATGGAACAGG + Intergenic
1013069521 6:106716004-106716026 CTGGAGCCAGGGTGGTGAAGTGG + Intergenic
1017115054 6:150968252-150968274 CTGGAGATACGGTGGTGAACAGG - Intronic
1017811221 6:157985151-157985173 CTGGAGACAGGGGCTTGAACTGG + Intronic
1018984513 6:168625955-168625977 CAGGAGTGAAGGTCTTGACCTGG + Intronic
1022288817 7:28981048-28981070 CGGGGCTGAGGGCGTTGAACAGG - Intergenic
1024374363 7:48620509-48620531 TTGGGGTGAGGGTGCTGCACAGG - Intronic
1028600674 7:92597249-92597271 CTGAAGTGAGGATGTTGACTAGG - Intergenic
1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG + Intronic
1030499609 7:110343021-110343043 ATGGAGTGTGGGTGTTGGAAAGG + Intergenic
1031428628 7:121638077-121638099 CTGGAGGGAGGGGATTGATCGGG + Intergenic
1032476919 7:132217846-132217868 CTGGAGTGGGGGTGGTGCATGGG + Intronic
1033302896 7:140202029-140202051 CTGGGATGAGGGTGTTGCCCAGG - Intergenic
1034947646 7:155273691-155273713 ATGGAGAGAGGGAGCTGAACTGG + Intergenic
1036744073 8:11391548-11391570 CTGGAGTGAGGCTGAGGAATGGG + Intronic
1037953487 8:23034977-23034999 CTGGTATGCAGGTGTTGAACTGG + Intronic
1038430555 8:27496239-27496261 CTGGCATGAGGCTTTTGAACTGG + Intronic
1039324867 8:36474321-36474343 CTGCAGTCAGGTTGTTGAGCAGG + Intergenic
1045242599 8:100415709-100415731 TGGGGGTGAGGGTCTTGAACCGG + Intergenic
1053786791 9:41658070-41658092 CTGGTTTCAGGGTGTTGACCTGG - Intergenic
1054158270 9:61656125-61656147 CTGGTTTCAGGGTGTTGACCTGG + Intergenic
1054478043 9:65587130-65587152 CTGGTTTCAGGGTGTTGACCTGG + Intergenic
1056802463 9:89702021-89702043 AGGGAGTGAGGGTTTGGAACGGG - Intergenic
1057201392 9:93142239-93142261 CGGGAGTGATGGTGTTCTACTGG - Intergenic
1058289455 9:103220152-103220174 CTTGAGTGAGGGTGTGGTAAGGG - Intergenic
1059506869 9:114807178-114807200 CTGCAGTGAGGGGGTTGAGGGGG + Intergenic
1059694649 9:116719460-116719482 CTTGAGAGAGGGTGTTGAGAAGG + Intronic
1059752608 9:117262494-117262516 ATGGATTGAGGGTGTTGAAGGGG - Intronic
1061453757 9:130682526-130682548 CTGGAGTGTGTGTGTTGGAAGGG - Exonic
1061586648 9:131573857-131573879 CTGGAGTCTGGGTGTTGAGATGG - Intergenic
1061759790 9:132842717-132842739 CTGCAGTCAAGGTGTTGACCAGG + Intronic
1062136754 9:134933182-134933204 CTGGAGTCAGGGAGTTTATCTGG - Intergenic
1062411070 9:136424785-136424807 CTGGAGTGTGTGTGTTGTAAAGG - Intergenic
1062639271 9:137509553-137509575 CTGGTGTGAGTGAGTTTAACTGG + Intronic
1185807634 X:3074845-3074867 CTGGGGTGAGGGTCGAGAACAGG - Intronic
1186575045 X:10756527-10756549 GTGAAGTGAGGGAGTTGGACTGG - Intronic
1186817598 X:13253175-13253197 CTGGAATCAAGGTGTTGAGCAGG - Intergenic
1187983191 X:24781443-24781465 CTGCAGTGAAAGTGTGGAACTGG + Intronic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1195940498 X:110163745-110163767 CTGGAGTGATGCTGTTGAGTAGG + Intronic
1199173326 X:144757157-144757179 GTGGAGTGGGGGTGTTGTGCTGG + Intergenic
1199988814 X:152972347-152972369 CTGAAGGGAGGGTGTTAACCTGG - Exonic