ID: 976401393

View in Genome Browser
Species Human (GRCh38)
Location 4:84611000-84611022
Sequence AAGAGAGCAAAGACGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976401393 Original CRISPR AAGAGAGCAAAGACGGAGCT GGG Intronic
901051291 1:6427010-6427032 AAGAGGGCACGGAGGGAGCTGGG - Intronic
903121593 1:21219922-21219944 GAGAGAGCCAAGACGGAGGAGGG - Exonic
903186442 1:21631969-21631991 GACAGAGCAGAGCCGGAGCTGGG - Intronic
903563756 1:24248808-24248830 AGGAGAGGAAGGATGGAGCTAGG + Intergenic
904089574 1:27935339-27935361 AAGATAGCAAGGCAGGAGCTAGG + Intronic
907228998 1:52977533-52977555 GAGATAGCAAAGTTGGAGCTGGG + Intronic
908655205 1:66381345-66381367 AAGAGAGTAAAGAAGGACGTGGG + Intergenic
910351465 1:86303625-86303647 AACAGAGCAAGGAGGAAGCTGGG - Intergenic
910402374 1:86850145-86850167 AAGAAAGCAATGATGGAGATGGG - Intergenic
914391316 1:147225587-147225609 AAGCGAGCACAGACGGGGCTAGG - Exonic
915931586 1:160063656-160063678 GGGAGAGCAGAGATGGAGCTAGG + Intronic
918520764 1:185412592-185412614 ATGAGAGCACTGAGGGAGCTGGG + Intergenic
918900819 1:190414630-190414652 AAAAGAGCAAAGACTCAACTGGG - Intronic
920387109 1:205576960-205576982 AAGAGAGAAAAGACGGAAAAGGG - Intronic
922750228 1:228066729-228066751 AAGAGAGCAAGGAGTCAGCTTGG - Intergenic
923397557 1:233582178-233582200 AGGAGAGCAAAGGGGGAGCAGGG + Intergenic
923430699 1:233917650-233917672 AAGAGAGAAAAGGTAGAGCTGGG - Intronic
923565909 1:235075767-235075789 GAGACAGCAAGGAAGGAGCTGGG + Intergenic
924148012 1:241097398-241097420 CAGAGAGAAGAGAGGGAGCTTGG - Intronic
924661266 1:246019665-246019687 AAGATAGCACAGATGGACCTAGG - Intronic
1062921845 10:1286108-1286130 GAGAGAGCCAAGAGGGGGCTTGG + Intronic
1063709924 10:8467638-8467660 AAGAAAGCAAAGACGTGGCAAGG + Intergenic
1065248057 10:23779321-23779343 AAGAAAGAAAAGGAGGAGCTTGG - Intronic
1066192586 10:33069509-33069531 GAGAGAGGAAGGAAGGAGCTAGG - Intergenic
1066460816 10:35610726-35610748 AAGAGAGGAAAGAGGCATCTGGG + Intergenic
1066497290 10:35954717-35954739 AAGAGAGAAAAGAGGGAGATGGG - Intergenic
1066624913 10:37396535-37396557 AAGAGAGAAAAGGGGGAGATGGG - Intergenic
1066625001 10:37397124-37397146 AAGAGAGAAAAGGGGGAGATGGG + Intergenic
1067343886 10:45424456-45424478 AACAGAGCAAAGGCAGAACTTGG + Intronic
1067563998 10:47323624-47323646 AAGATAACAAACACGGACCTAGG + Intronic
1068443030 10:57084124-57084146 GAGAGAGAAAAAAGGGAGCTGGG - Intergenic
1071873016 10:89815750-89815772 AAGAGAGCTAAGACAGGGCTGGG - Intergenic
1073883407 10:108008917-108008939 CAGCAAGCAAAGACAGAGCTTGG + Intergenic
1076418592 10:130311059-130311081 CAGAGAGGAAAGTTGGAGCTGGG - Intergenic
1076663374 10:132069908-132069930 ATGGGAGCACAGACGGGGCTCGG + Intergenic
1076990815 11:272615-272637 AAGAGGACAAAGACGGAGGGAGG + Intergenic
1079206424 11:18419034-18419056 AGGAGACCAGAGACAGAGCTTGG + Intronic
1079660076 11:23026664-23026686 AAGAGAGCAAGAACGTAGTTTGG + Intergenic
1080005054 11:27397889-27397911 AAGAGAGCAAAGACAGAGAATGG + Intronic
1080174511 11:29345832-29345854 AATAGAGCAAAGAATGAGGTAGG + Intergenic
1083919783 11:65776189-65776211 AGGAGAGGAAAGACGGGCCTGGG - Exonic
1084399859 11:68937243-68937265 AGGGGAGCCCAGACGGAGCTGGG - Intronic
1088174513 11:107036054-107036076 AAGAGTGCAAAGAAGAATCTTGG - Intergenic
1088306327 11:108412523-108412545 AAAAGAACAAAGACGAACCTGGG + Intronic
1089758193 11:120702530-120702552 AAGAGGACAAGGACAGAGCTCGG + Intronic
1090275016 11:125413041-125413063 AAGAGATGAGAGCCGGAGCTCGG + Intronic
1090532783 11:127608389-127608411 AATAGATCAAAGGCAGAGCTGGG + Intergenic
1092859534 12:12708607-12708629 AAGAGAGCAGAGAAGGCACTAGG - Intergenic
1093657591 12:21714245-21714267 AAGAGAGAAAAGATGGTTCTGGG - Intronic
1095716210 12:45349578-45349600 AAGAAAGTAAAGACTGAGATTGG + Intronic
1095848276 12:46771656-46771678 AACAGAGCAAAGAGGGAGGGAGG + Intronic
1096814263 12:54191758-54191780 AAGTGAGCAGAGTCGGAGCTAGG - Intergenic
1097175350 12:57139255-57139277 GAGAGAACAGAGACGGACCTAGG - Intronic
1098032557 12:66269360-66269382 CAGGGAGCAAAGACAGAACTGGG - Intergenic
1098293429 12:68980616-68980638 AATACAGCAATGAGGGAGCTGGG - Intergenic
1099037132 12:77602615-77602637 AAGAGAGCAGAGGGGGAGATGGG + Intergenic
1099133658 12:78865396-78865418 AAGAGAGAAAAGATTGAGATTGG - Intronic
1100229153 12:92589611-92589633 AAGAGAGCAATCACGGGGGTGGG - Intergenic
1100379806 12:94051060-94051082 AAGAGAGCAAGATGGGAGCTGGG - Intergenic
1100874911 12:98951653-98951675 AAGAGGGCACAGACAGGGCTTGG - Intronic
1101554563 12:105796492-105796514 AAGAGAGCCAAGACTGACATTGG - Intergenic
1101968679 12:109297495-109297517 AAAAATGCAAAGACTGAGCTGGG - Intronic
1102015099 12:109643016-109643038 AATGGAGCAAAGATGGAGGTAGG - Intergenic
1103167718 12:118784615-118784637 AAGAGAACAAAGAGGCAGGTTGG + Intergenic
1104301726 12:127570603-127570625 AAGAGAGGAAAGAAGGAGGAAGG + Intergenic
1104483924 12:129133030-129133052 CTGGGAGCAAAGACTGAGCTTGG - Intronic
1107412927 13:40174153-40174175 AAAAGGGGAAAGATGGAGCTTGG - Intergenic
1107609819 13:42102076-42102098 AAGAGATCAAGGCCGGGGCTGGG + Intronic
1107780044 13:43890293-43890315 AAGAGAGGAAAAACGGAGAGAGG - Intronic
1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG + Intergenic
1108140113 13:47411581-47411603 AAGAGGGCAAAGAGGGGGCCTGG + Intergenic
1109024482 13:57141249-57141271 AAGAGAGCAAGAACGGATTTAGG - Intronic
1109025469 13:57147819-57147841 AAGAGAGCAAGAACGGATTTAGG - Intronic
1109026459 13:57154392-57154414 AAGAGAGCAAGAACGGATTTAGG - Intronic
1109027451 13:57160963-57160985 AAGAGAGCAAGAACGGATTTAGG - Intronic
1109028437 13:57167528-57167550 AAGAGAGCAAGAACGGATTTAGG - Intronic
1110794365 13:79619817-79619839 AAGAGAGCAAAGAGGGGTATGGG - Intergenic
1112563947 13:100536596-100536618 CAGAGAGAAAAGAGGGAGTTAGG - Intronic
1113308835 13:109109480-109109502 TAGAGAGCAAGAACAGAGCTGGG + Intronic
1114171643 14:20278789-20278811 AAGAGAGAAAAGAAAGAGCAAGG + Intronic
1114453276 14:22839857-22839879 AAGAAAGCAAAGCTGGAGCAGGG + Intronic
1115552859 14:34520185-34520207 AAGAGAGAAAAGAAAGAACTGGG - Intronic
1118332398 14:64824572-64824594 AAGAGAGCAAAGCGGGAGGCAGG + Intronic
1118581706 14:67306661-67306683 AAAAGAGAAAAGAAGGGGCTGGG - Intronic
1118606510 14:67507841-67507863 AAAAGAGCAATGACTGGGCTGGG + Intronic
1118718348 14:68576132-68576154 ACCAGAGCAAAGAGGGAGCAGGG + Intronic
1118882459 14:69841195-69841217 AAAGGAGCCAAGACGGAGCAGGG - Intergenic
1119580622 14:75776362-75776384 AGGAGAGGAAAGACAGATCTTGG - Intronic
1120878907 14:89399322-89399344 AAGAGCACACAGAGGGAGCTGGG + Intronic
1121018530 14:90563900-90563922 AAGAGAGCAAGAATGGAGCCCGG - Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121056440 14:90858839-90858861 AAGAGACAAAAGTTGGAGCTTGG + Exonic
1121601515 14:95208170-95208192 AAGTGAGCAAAAACGTAACTTGG - Intronic
1122020486 14:98833913-98833935 ATGAGAGGACAGAAGGAGCTGGG + Intergenic
1124094724 15:26638429-26638451 AAGAGAGGAAGGAAGGAGCACGG - Intronic
1124708626 15:31986116-31986138 AAGGAAGGAAAGACGGAGGTGGG + Intergenic
1125583455 15:40803858-40803880 AAGAGACCAAGGTCTGAGCTGGG - Intronic
1126403326 15:48296902-48296924 AAGAGTGCAAAGACAAAACTGGG + Intronic
1133071634 16:3250313-3250335 ATGAAAGCAAAGAAGGGGCTGGG + Intronic
1133470339 16:6069074-6069096 AAGAGAGGAAGGAAGGAGCGAGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1138093461 16:54194599-54194621 TGGGGAGCAGAGACGGAGCTGGG - Intergenic
1138527597 16:57618007-57618029 AAGAGGGGCAAGAGGGAGCTGGG + Intronic
1142232293 16:88905607-88905629 AGGAGAGCAAAGATGGAAGTGGG + Intronic
1142499005 17:321942-321964 AAGAGAAGAAAAAGGGAGCTCGG + Intronic
1143140725 17:4740464-4740486 AGGAGAGCAATGATGGAGTTTGG - Intronic
1146727003 17:35164534-35164556 AAGAGAGCCAAGACAGAGCAAGG + Intronic
1149234698 17:54576439-54576461 AAGAGACCAAATACTGAGCTAGG + Intergenic
1152779430 17:82219701-82219723 AAGGGTGCAAAGAGGGGGCTGGG + Intergenic
1152942281 17:83178932-83178954 AAGACAGCAAGGACAGAGCCAGG + Intergenic
1153210743 18:2761261-2761283 AAGAGGGGAAAGAGGGAGGTGGG + Intronic
1153323273 18:3793654-3793676 GAGAGCGCAAAGAGAGAGCTAGG - Intronic
1153810730 18:8749594-8749616 AAGAAAGCAGAGCCTGAGCTTGG + Intronic
1158219038 18:55130815-55130837 CAGAGAGCAAAGCCTGACCTCGG + Intergenic
1159785245 18:72705822-72705844 AAGAGATAAAGGAAGGAGCTTGG + Intergenic
1160729627 19:635234-635256 GAGGGAGCAAAGATGTAGCTGGG + Intergenic
1161706622 19:5825142-5825164 GAGAGAGGAGAGACGGGGCTGGG + Intronic
1162891611 19:13737319-13737341 AAGAGAGCAAAGAAGTGGCCAGG - Intronic
1163198471 19:15743415-15743437 AAGAGAGAAAAAAAGGAGGTTGG + Intergenic
1166510782 19:43407517-43407539 AAGAAAAGAAAGCCGGAGCTGGG + Intronic
1167386361 19:49166317-49166339 AAGAGAGCCAAGACAGGGATGGG - Intronic
1168306612 19:55439351-55439373 AAGAGGACAAGGACGGAGCTGGG - Intronic
1168512412 19:56983398-56983420 GAGGGAGCAAAGAGAGAGCTTGG + Intergenic
925358194 2:3257583-3257605 CAGGCAGCAAAGACGGAGCAGGG + Intronic
925547028 2:5027797-5027819 AATAGAGGAAAGAGGGAGCGAGG - Intergenic
926355369 2:12036551-12036573 AAGAGAGTAAATTCAGAGCTGGG + Intergenic
926368786 2:12159654-12159676 AAGAAAGGAAAGAAGGAGGTAGG - Intergenic
927489220 2:23509735-23509757 AATACAGCAAAGCCTGAGCTTGG + Intronic
927737817 2:25537809-25537831 AAGGAAGCAAAGAGGGAGCGAGG + Intronic
928467752 2:31538636-31538658 AAGAGAGCAGAGATGTAGTTGGG - Intronic
928705322 2:33943620-33943642 AAGAGAGAAAAGAAGGAAGTGGG + Intergenic
932909184 2:75788081-75788103 AACAGAGCAGACACCGAGCTGGG - Intergenic
933569373 2:83991594-83991616 AAGAGAAAAAAGAGGGGGCTGGG - Intergenic
934938307 2:98481023-98481045 AAGAGAGCAAAGCAGCACCTGGG + Intronic
935693519 2:105750834-105750856 AAGAGAGCAAAGCAAGAGGTGGG + Intronic
937256296 2:120558127-120558149 AAGAGGGCATAGAGGGACCTAGG - Intergenic
937352046 2:121172136-121172158 AAGAAATCAACGAGGGAGCTTGG + Intergenic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
941607202 2:167613095-167613117 GAGAGAGGAAAAAGGGAGCTAGG + Intergenic
942255057 2:174088718-174088740 AAGAGAGCTAAGGCCGGGCTTGG + Intronic
943289287 2:186047931-186047953 CAGAGAGCAAAGGCGAAGCAGGG + Intergenic
944020680 2:195099830-195099852 AAGAGAGGAAAGAGGGAGTGGGG + Intergenic
944288497 2:197977885-197977907 AAGAGAACAAAGACAGAGGTGGG - Intronic
945367260 2:208970226-208970248 AAGTGAGCCAAGACGGGGCTGGG + Intergenic
1169100747 20:2946419-2946441 AAGAGAGCAAACATGGAATTGGG + Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1169364529 20:4981153-4981175 CAGAGAGCAAAGATAGAGCAGGG - Intronic
1169588248 20:7111467-7111489 AAGAGACCAAGGACAGGGCTTGG - Intergenic
1169766961 20:9156970-9156992 CAGAGAGCAGACACGGAGCTTGG + Intronic
1172873142 20:38148106-38148128 AAGAGGAGAAAGAGGGAGCTGGG + Intronic
1172946226 20:38691751-38691773 TAGAGACCAAAGAAGGAACTTGG - Intergenic
1173539348 20:43839713-43839735 AAGAGAGAAAATACAGAGATGGG - Intergenic
1174945577 20:54981496-54981518 AAGAGAGCCAAGAGGGAGTGTGG - Intergenic
1177752586 21:25303553-25303575 AAGAGAAGAAAGACTGAGCATGG - Intergenic
1178084271 21:29096791-29096813 AAGAGAGCAAAGAGATAGATCGG - Intronic
1179224743 21:39443705-39443727 AAAAGAGAAAAGATGGGGCTAGG + Intronic
1179917047 21:44484605-44484627 CAAAGAGCAAAGAAGGAGTTCGG + Intergenic
1180910019 22:19443251-19443273 AAGAGAGCAGGGAGGGTGCTGGG + Exonic
1182227273 22:28808672-28808694 ATGAGAACAAAGACGGTACTTGG - Intergenic
1182835953 22:33341488-33341510 AATAGAGGACAGAGGGAGCTGGG - Intronic
1184064084 22:42106022-42106044 GATAGAGCAAAGAGAGAGCTTGG + Intergenic
950895623 3:16447967-16447989 AAGAGAGAAAAGAAGGAGAGAGG - Intronic
952877881 3:37962436-37962458 AAGAGAGAAAAGATGGAGAAGGG - Intronic
953914001 3:46906486-46906508 TCGAGAGCAAGGACTGAGCTGGG + Intergenic
954535185 3:51354603-51354625 AAGAGAGCAAGGTGGGAGATGGG - Intronic
955182067 3:56682392-56682414 CAGAGAGGAAAGATGGTGCTCGG - Intronic
955330334 3:58041925-58041947 AAGAAAGCAAAGAGGGCACTTGG - Intronic
956766284 3:72487292-72487314 AAGAGAGCAAAGAAGGAACCAGG + Intergenic
956777530 3:72577834-72577856 AGGAAAGGAGAGACGGAGCTGGG - Intergenic
957211664 3:77266845-77266867 GAGAGAGTAAAGAGGGAGCAAGG - Intronic
959768817 3:110068502-110068524 AAGAGAACAAAGACGGAAAGAGG - Intergenic
960088738 3:113617358-113617380 CAGAGAGCCAAGAGAGAGCTGGG - Intronic
961532371 3:127547485-127547507 AAGGGAGGAGGGACGGAGCTGGG + Intergenic
962630611 3:137272060-137272082 AAGAGAGCTCAGACGGCTCTGGG - Intergenic
964696997 3:159520170-159520192 GAGAATGCAAAGACGGAGGTAGG + Intronic
965532374 3:169785592-169785614 AAGAGTTCAAAGATGGAGATGGG + Intronic
966142942 3:176776873-176776895 AAGAGAGAACAGATGTAGCTGGG - Intergenic
966638746 3:182164868-182164890 CAGATACCAAAGAAGGAGCTGGG - Intergenic
969130697 4:4989240-4989262 AGGTGAGAAAAGACGGAGCGAGG - Intergenic
969319346 4:6402455-6402477 AAGAGAGAAAAGAGGGAGGGTGG - Intronic
969929348 4:10614887-10614909 AGAAGAGCAAAGAAGGGGCTGGG + Intronic
970564905 4:17322328-17322350 AAGACAGCAAAGCTTGAGCTAGG + Intergenic
971876052 4:32309834-32309856 AAGAGCACAAAGAAGGAACTGGG - Intergenic
971985265 4:33814207-33814229 CAAAGAGTAAAGACGGAGTTGGG + Intergenic
972765474 4:42149955-42149977 AGGAGATCAAAGACTGACCTGGG + Intronic
973884475 4:55306616-55306638 AAGAAAGCACAGGCGGAACTGGG + Intergenic
974018607 4:56673275-56673297 AAGAGAGAAAAGAGGGAGAGTGG + Intronic
976059247 4:81107136-81107158 AAGAGGAGAAAGACGGAGTTGGG + Intronic
976369242 4:84267896-84267918 ATGAGAGCAATAAGGGAGCTGGG + Intergenic
976401393 4:84611000-84611022 AAGAGAGCAAAGACGGAGCTGGG + Intronic
977323384 4:95547649-95547671 AAGAGACCCAAGTAGGAGCTGGG + Intronic
979310096 4:119193042-119193064 GAGAGAGCAAAGTGGGAACTGGG - Exonic
980427370 4:132643952-132643974 AAGAGAGAAAGGAAGCAGCTTGG - Intergenic
983406934 4:167343098-167343120 ATGAGAGGAAAGAAGGAGGTGGG - Intergenic
983660263 4:170124621-170124643 AAGAGAGAAAAGAAGAAGTTTGG - Intergenic
983969433 4:173852892-173852914 AAGCGAGGTAAGAAGGAGCTGGG + Intergenic
984927655 4:184820557-184820579 AAGACAGGAAGGACAGAGCTGGG - Intronic
985107562 4:186514046-186514068 AGGAGAACAAAGACTGATCTTGG + Intronic
986604141 5:9504720-9504742 ATGAGGGCAAAGAAGGAGCTGGG + Intronic
987066778 5:14297608-14297630 ATAAGAGCAAAGAAGGAGCCAGG - Intronic
988814360 5:34818913-34818935 AAGAGAGCAAAGGCCAAGCTGGG + Intronic
993235022 5:85293619-85293641 GAGAGAGCAAAGCCGGAAGTGGG - Intergenic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
995777427 5:115738958-115738980 AACAGATCAAAGAATGAGCTGGG + Intergenic
997904826 5:137806243-137806265 AAGACAGCAAAGGCGGAGGTGGG - Intergenic
1002397790 5:178971526-178971548 GAGACAGCAAACACTGAGCTGGG - Intergenic
1003322567 6:5064450-5064472 AACAGAGCAAACAGTGAGCTTGG - Intergenic
1006699186 6:35957908-35957930 AGGAGAGAAAAGAAGGATCTCGG - Intronic
1006866959 6:37216432-37216454 AAGGGAGCAAAGGTGGAGGTAGG + Intronic
1008268340 6:49460015-49460037 AAGAGGACAAAGACAGAGATGGG - Intronic
1008988503 6:57575219-57575241 AAGAGAGAAAAGATGGATCTTGG - Intronic
1010302063 6:74272886-74272908 AATAGAGAAAAGAGGGAGTTGGG - Intergenic
1011912728 6:92463057-92463079 AAGAGAGGAAAGACAGAGCAAGG - Intergenic
1012705295 6:102519744-102519766 AAGATAACTAAGACTGAGCTTGG + Intergenic
1012894050 6:104928721-104928743 AGCAGAGCTAAGACAGAGCTAGG - Intergenic
1013678790 6:112499461-112499483 AAGAGAGTAAATATGGTGCTAGG - Intergenic
1015497212 6:133894324-133894346 CAGAGAGCAAAGTCAGAGCCTGG + Exonic
1017540830 6:155400842-155400864 ATGAGACCAATGAGGGAGCTGGG - Intronic
1022192025 7:28025826-28025848 ATGAGAGCTAGGGCGGAGCTGGG + Intronic
1023956123 7:44888148-44888170 AAGAAACCAGAGAAGGAGCTGGG - Intergenic
1024474219 7:49793055-49793077 AAGAAAGCAAAGACAGAGAGTGG - Intronic
1024657966 7:51467865-51467887 AAGAGACCACAGACAGAACTTGG - Intergenic
1026120797 7:67535239-67535261 AAGAGAGCAAACTAGGAGGTGGG - Intergenic
1028910027 7:96197414-96197436 AAGAGAGCAAAAAGGGAGTGAGG - Intronic
1029255018 7:99263802-99263824 AAGAGAGGCAGGACTGAGCTTGG - Intergenic
1031669561 7:124526093-124526115 CAGAGGGCAAAGATGGAACTGGG - Intergenic
1032849900 7:135785152-135785174 GAGAGAGCAAAGGAGGGGCTGGG - Intergenic
1033061281 7:138110813-138110835 AAGAAAGCTAATACGGAGCCAGG + Intronic
1033461405 7:141550613-141550635 AAGAGAGCAACGGAGAAGCTAGG - Intergenic
1034721048 7:153293154-153293176 AAGAAAGCAAATAAGGACCTTGG - Intergenic
1034857241 7:154563322-154563344 CAGAGAGCTAAGAGGGAACTAGG + Intronic
1035327243 7:158073096-158073118 GAGAGTGCAAAGATGGTGCTGGG - Intronic
1036633389 8:10531005-10531027 AATACAGCAAAGGCCGAGCTGGG - Intronic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1040860939 8:51998874-51998896 AACAGAGCAAAGACTGAGGAAGG + Intergenic
1041413042 8:57577694-57577716 AAGACAGCAAAGATTGTGCTTGG + Intergenic
1044810598 8:96057609-96057631 AAGAGAGGAAAGAGGGAGAGAGG + Intergenic
1045508936 8:102798529-102798551 ACGAGAGAAAAGACGGATCTAGG - Intergenic
1046190629 8:110790185-110790207 AAATGAGCAAAGACACAGCTTGG + Intergenic
1047166762 8:122447899-122447921 AAGAGAGCATAGACCCAGGTGGG + Intergenic
1047415150 8:124658618-124658640 CAGAATGCAAAGAGGGAGCTAGG + Intronic
1049682554 8:143926161-143926183 GAGAGAGCAAAGCAGGAGCTCGG + Intronic
1050314527 9:4387648-4387670 AATAGATCAAAGAATGAGCTAGG + Intergenic
1050406553 9:5314567-5314589 AACAGAGCACTGACTGAGCTGGG + Intergenic
1051583555 9:18703303-18703325 AAGATAGTAAATACAGAGCTGGG + Intronic
1052083142 9:24231407-24231429 AAGAGAGCTAACACGTAGTTGGG + Intergenic
1052795314 9:32918662-32918684 AAGAAAGCAAAGACTGATATGGG - Intergenic
1052854297 9:33397546-33397568 AATAGAGCAAAGACTGGGATGGG + Intronic
1053005541 9:34601932-34601954 AAGGAAGCAAAGACAGGGCTAGG + Intergenic
1053932288 9:43122033-43122055 AATAGAGCAAGGACTGGGCTGGG + Intergenic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1056560893 9:87728169-87728191 AAGAGAGGAAGCACAGAGCTCGG - Intronic
1058454006 9:105122335-105122357 AAGAGAGCAAAATCGGAATTAGG + Intergenic
1062343785 9:136105441-136105463 CAGAGAGCAGGGAGGGAGCTGGG + Intergenic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1186658716 X:11645705-11645727 AAGACTGCAAAGAAGAAGCTTGG + Intronic
1188359001 X:29229248-29229270 AAGAGAACAAAGACTGACATTGG - Intronic
1189519261 X:41748720-41748742 ATGAGGGAAAAGACGGAGCCTGG + Intronic
1189717514 X:43881613-43881635 CAGAGAGCAAAGCTGCAGCTTGG + Intronic
1189864768 X:45315492-45315514 AAAAGAACAAAAACGAAGCTGGG - Intergenic
1191607284 X:63076623-63076645 AAGACAGCAAAGAGGGAGTAGGG + Intergenic
1192262070 X:69511422-69511444 AAGAGAGCAGAGAGGGAGAGGGG - Intronic
1192353352 X:70375995-70376017 AAGAGAGAAAAGCCAGAACTAGG - Intronic
1193582012 X:83276893-83276915 AAGAGAGCAGAGAAGGATCAAGG - Intergenic
1194340651 X:92700912-92700934 AAGAGCACCAAGAGGGAGCTTGG - Intergenic
1194698050 X:97080172-97080194 AAGAGAGGAAAGAAGGAGGGAGG - Intronic
1195205761 X:102599076-102599098 AAGAGAGTCAAGACTGAGATAGG - Intergenic
1195233864 X:102877896-102877918 AAGGGAGCAAAGACAGAGAGAGG + Intergenic
1197334247 X:125192492-125192514 ATGAGAACAAAGATGGATCTAGG + Intergenic
1197868584 X:131044454-131044476 AAGAGAGGAGGAACGGAGCTAGG + Intergenic
1198177023 X:134166672-134166694 AGGTGAACAAAGGCGGAGCTGGG + Intergenic
1198225475 X:134641279-134641301 AAGAAAGAAAAGACTGAGATAGG + Intronic
1199159492 X:144591635-144591657 AAGAGATCAAAGTTGGAGTTGGG + Intergenic
1200649006 Y:5817650-5817672 AAGAGCACCAAGAGGGAGCTTGG - Intergenic