ID: 976407544

View in Genome Browser
Species Human (GRCh38)
Location 4:84677303-84677325
Sequence GCCGTTCTGCTGCTGATCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976407544_976407548 12 Left 976407544 4:84677303-84677325 CCAGTGATCAGCAGCAGAACGGC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 976407548 4:84677338-84677360 TCACAGACCAGCTGAAAACTCGG 0: 1
1: 0
2: 4
3: 17
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976407544 Original CRISPR GCCGTTCTGCTGCTGATCAC TGG (reversed) Exonic
902799393 1:18819889-18819911 GACGTGGTGCTGGTGATCACCGG - Intergenic
906945233 1:50289326-50289348 CCTCTCCTGCTGCTGATCACGGG + Intergenic
914293537 1:146297776-146297798 GCCGTGGTGCTGCTGCTCAGTGG + Intergenic
914554581 1:148748559-148748581 GCCGTGGTGCTGCTGCTCAGTGG + Intergenic
914934281 1:151964613-151964635 GCAGTTCTGCTCCTGAGCAGAGG - Intergenic
916420380 1:164632469-164632491 GCCTTTCTCCTGCTGGACACAGG + Intronic
917586681 1:176434189-176434211 GCCTTTCTGCTGATATTCACAGG + Intergenic
917901381 1:179546493-179546515 GAACTTCTGCTGCTCATCACTGG + Intronic
924214898 1:241810920-241810942 GCCATTCTGCTGATAATTACAGG - Intergenic
1062973063 10:1662917-1662939 GGCGTTCTGCTGATGCTCCCAGG - Intronic
1076637419 10:131891521-131891543 GCCGTTCTCCAGCCGACCACAGG + Intergenic
1077265765 11:1648722-1648744 GCCCTTCTGCTGCTCACCGCGGG + Intergenic
1078148576 11:8739652-8739674 CCAGTTCTGCTGCTCAACACAGG + Intronic
1079524792 11:21372813-21372835 CCTGGTCTGCTACTGATCACAGG - Intronic
1081049785 11:38324270-38324292 GCCCTGCTGATGCTGTTCACAGG + Intergenic
1086982731 11:93216536-93216558 ACATTTCTGCTGCTGTTCACAGG + Intergenic
1089076532 11:115743031-115743053 GCCCTTCTGCTGCTGAGGACTGG - Intergenic
1096874166 12:54614289-54614311 GCAGTTCTGATGCTGAGAACAGG + Intergenic
1101833818 12:108281046-108281068 TCCATTCTGCTGCTCAACACAGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1104298182 12:127538029-127538051 GCTTCTCTGCTGCTGAACACAGG + Intergenic
1106502292 13:30340531-30340553 GCAGTTCTGCAGCTTATCAGGGG - Intergenic
1107144245 13:37041011-37041033 GCTGTTCTTCTGCAGCTCACAGG + Intronic
1109781180 13:67112382-67112404 AGAGTTCTGCTGCTGATCATAGG - Intronic
1113500832 13:110772754-110772776 GCCTTTCTTGTGCTGATGACCGG + Intergenic
1119769834 14:77213594-77213616 GCAGTTCTGCTGGTGGTCATTGG - Intronic
1120988654 14:90355659-90355681 GCCCTTCTGCTGATGAGCTCTGG + Intergenic
1122304932 14:100758067-100758089 GCTGTTCTGCTGCTGCTGAGTGG - Intergenic
1124865488 15:33486734-33486756 GCACTTCTGCTGCTCAGCACTGG - Intronic
1129115637 15:73363972-73363994 GACTTCCTGCTGCTGGTCACTGG - Intronic
1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG + Intergenic
1137375719 16:47950124-47950146 GCCATTCTGCAGCTGAGCCCTGG + Intergenic
1139969633 16:70765723-70765745 GCCGTTCTGCTGCCCCTCCCAGG - Intronic
1144307735 17:13984358-13984380 GCAGTCCTTCTGCTGATCACTGG - Intergenic
1146466261 17:33089085-33089107 GCCATTATTCTGCTTATCACAGG - Intronic
1150038777 17:61834871-61834893 GCATTTCTTCTGCTGATCTCAGG - Intronic
1152258828 17:79255670-79255692 CCAGTGCTGCTGCTGAGCACCGG - Intronic
1157102649 18:44744332-44744354 GTTGTTCTGCAGCTGATAACCGG + Intronic
1165474004 19:36019100-36019122 GCAGTTCTGATGCTGCTGACTGG - Intronic
926292224 2:11540190-11540212 GCCATTATTCTGCTGAACACAGG - Intronic
934936793 2:98471548-98471570 GCCATGCTGCTGCTTCTCACAGG + Intronic
936471791 2:112805423-112805445 GCCCTGCTGCTGCTGACCAGGGG + Intergenic
946191128 2:218008546-218008568 GCCCTGCAGCTGCAGATCACAGG - Intergenic
947433000 2:230046879-230046901 GTCTTTCTGCTGCTTATCCCTGG - Intronic
1169380308 20:5100897-5100919 GCCGTTCCAGTGCTGATCATTGG - Exonic
1172092374 20:32442813-32442835 GCCCTTCAGTTGCTGAGCACAGG - Intergenic
1172689189 20:36778772-36778794 GCCATCCTGGTGCTCATCACAGG + Exonic
1174675516 20:52350411-52350433 GCAGCTCTGCTGGTGATCCCTGG - Intergenic
1175248278 20:57594240-57594262 GCCGTTCGTCTGCGGAGCACAGG - Intergenic
1181688959 22:24547757-24547779 GCCTCTCTGCTGCTGCTCCCTGG + Intronic
950883858 3:16346030-16346052 GCCGTTCTGGTGAAGATCATGGG - Intronic
963138329 3:141928121-141928143 GCCTTTCTGCTGCTGACTTCAGG + Intergenic
968461857 4:730186-730208 GCAATTCTGCTGCTGTGCACAGG - Intronic
968795407 4:2700434-2700456 GCTGTTCTGCTGATGCTCACCGG - Exonic
969286574 4:6206201-6206223 GCCTTCATGCTGCTGTTCACTGG - Intergenic
970053540 4:11945155-11945177 GCCTTGCTGCTGCTGGTCACTGG + Intergenic
975246425 4:72125914-72125936 GCCATTATGCTGCTGACCATAGG + Intronic
976407544 4:84677303-84677325 GCCGTTCTGCTGCTGATCACTGG - Exonic
983194852 4:164795909-164795931 TCCATTCGGCTTCTGATCACAGG + Intergenic
991495669 5:67223474-67223496 GCCCTTCTGCTAGTGATCACTGG + Intergenic
999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG + Intronic
1003755604 6:9116213-9116235 GGCCTTCTGCTGCTAATTACTGG + Intergenic
1014401368 6:120994365-120994387 GCACTTCTGCTGCTCATCAGGGG - Intergenic
1019172193 6:170138852-170138874 GCCGTTCTCCAGGTGCTCACGGG - Intergenic
1019172244 6:170139176-170139198 GCCGTTCTCCAGGTGCTCACGGG - Intergenic
1019172270 6:170139338-170139360 GCCGTTCTCCAGGTGCTCACGGG - Intergenic
1019172283 6:170139419-170139441 GCCGTTCTCCAGGTGCTCACGGG - Intergenic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1029596424 7:101539898-101539920 GCCGTTCTGCTGCTTCTAGCAGG - Exonic
1036057010 8:5266702-5266724 GCCATCCTGCTGTGGATCACTGG + Intergenic
1036594594 8:10200504-10200526 GCCTTGCTGCTCCTCATCACGGG + Intronic
1037905471 8:22713723-22713745 GCAGCTCTGCTGCTGTTCAGAGG - Intronic
1038932510 8:32210312-32210334 GCCATTGCTCTGCTGATCACTGG - Intronic
1039441325 8:37597368-37597390 GCAGTTCTGCGGGTGATCACAGG - Intergenic
1039475753 8:37838655-37838677 GCAGGCCTGCTGCTGGTCACAGG + Intronic
1039980106 8:42402190-42402212 GCTGTGCTGCTGGTGGTCACTGG + Intronic
1049376200 8:142290270-142290292 GCAGTTCTGGTGCTGTTCTCGGG + Intronic
1052143928 9:25024832-25024854 GCAGGTCTGCTGCAGTTCACTGG + Intergenic
1055215767 9:73860218-73860240 GCCTTTCTACTTCTGTTCACTGG - Intergenic
1056774214 9:89499140-89499162 GCTGTTTTCCTGCTGAGCACTGG + Intergenic
1058259914 9:102815258-102815280 GCAGGTCTGCTGCAGTTCACTGG - Intergenic
1059526409 9:114994789-114994811 GCATCTCTGCTTCTGATCACTGG - Intergenic
1062629844 9:137458772-137458794 GCCGGTCGGCTGCTGTTCCCCGG + Intronic
1186581034 X:10818950-10818972 GCCATTCTGCAGGTCATCACAGG + Intronic
1188465490 X:30474891-30474913 GCCGTTCTGCCACTTAACACTGG - Intergenic
1201578911 Y:15490745-15490767 GGCTTTCTGCTGCGGATCAGGGG + Intergenic