ID: 976409737

View in Genome Browser
Species Human (GRCh38)
Location 4:84699730-84699752
Sequence TAGGATGACCATAATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976409737_976409742 -8 Left 976409737 4:84699730-84699752 CCCACCCCATTATGGTCATCCTA 0: 1
1: 0
2: 1
3: 2
4: 101
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409737_976409744 5 Left 976409737 4:84699730-84699752 CCCACCCCATTATGGTCATCCTA 0: 1
1: 0
2: 1
3: 2
4: 101
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976409737 Original CRISPR TAGGATGACCATAATGGGGT GGG (reversed) Intronic
902070855 1:13735652-13735674 TAGGATGTTGATAATGGGGAAGG - Intronic
902295509 1:15464120-15464142 TAGGAAGCCCAGAATGGGGTAGG + Intronic
903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG + Intronic
904271126 1:29350707-29350729 AAAGCTGACCATAATGGTGTTGG - Intergenic
908843852 1:68304857-68304879 TAGGATGAAGATAATGGTGGAGG - Intergenic
909030755 1:70536793-70536815 TTTGATGACTATAACGGGGTGGG - Intergenic
909088220 1:71193073-71193095 AAGGATGACCTTGATGGGGCAGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913658520 1:120984851-120984873 GAGGAAAACCATAATTGGGTTGG - Intergenic
914009887 1:143767960-143767982 GAGGAAAACCATAATTGGGTTGG - Intergenic
914523133 1:148436090-148436112 GAGGAAAACCATAATTGGGTTGG - Intergenic
914648507 1:149676621-149676643 GAGGAAAACCATAATTGGGTTGG - Intergenic
915772490 1:158442542-158442564 GAGGATGACCATGATGGTGATGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916237061 1:162600605-162600627 TAGGATGTCATTCATGGGGTGGG + Intergenic
918039281 1:180902562-180902584 TAAGATGAATATAGTGGGGTGGG + Intergenic
919983420 1:202656806-202656828 TGGGAAGAGCATAATGTGGTGGG - Intronic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
923536852 1:234859101-234859123 TAGGAAAACCATAATTGGGGTGG - Intergenic
1063023842 10:2157875-2157897 TAGGATAATCAGAATGGGTTTGG + Intergenic
1064140729 10:12788086-12788108 CAGGATGACAATATTGGGGATGG - Intronic
1065244942 10:23747394-23747416 TATGAAGATGATAATGGGGTGGG + Intronic
1068026980 10:51658358-51658380 CAGGATTACCATAATAGGGCAGG + Intronic
1075448194 10:122528461-122528483 GAGGATGAACATAATGGTGAGGG - Intergenic
1079112763 11:17614148-17614170 GAGGATGCCCATATGGGGGTGGG - Intronic
1080589110 11:33705949-33705971 TAGGATCAGCCTACTGGGGTTGG + Intronic
1086928130 11:92663006-92663028 TAGGAAGACTGTGATGGGGTAGG + Intronic
1088129092 11:106465523-106465545 AATGATGACCTTGATGGGGTAGG + Intergenic
1091148214 11:133299750-133299772 TAGGATGACCCTAATTTGGATGG + Intronic
1093679840 12:21989377-21989399 TATTATGACCCTAATGAGGTAGG - Intergenic
1098199158 12:68036475-68036497 GAGGATGACTATAATGGATTTGG + Intergenic
1103659275 12:122500707-122500729 GAGGAGGACGAAAATGGGGTCGG - Intergenic
1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG + Intronic
1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG + Intergenic
1108408870 13:50128220-50128242 TAAGCTGACCAGATTGGGGTTGG - Intronic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1110202959 13:72874857-72874879 GGGGATGTTCATAATGGGGTAGG - Intronic
1113089323 13:106600396-106600418 CAGGATGACCTTCATGGGCTTGG - Intergenic
1118175886 14:63439763-63439785 TAGGATGTCCATCATGGAGATGG + Intronic
1126641910 15:50836154-50836176 TAGGATGTCCATAGTGGGTGAGG - Intergenic
1127299084 15:57634932-57634954 TAGGAGGACAATAATGTGGGAGG - Intronic
1131505198 15:93011738-93011760 TAGGGTGAACATAATGGAATTGG + Intronic
1131880184 15:96854073-96854095 TAGGATGAGCATATAGGGGAGGG - Intergenic
1138255834 16:55559137-55559159 TATGATGCACATAATGGTGTTGG - Intronic
1141429180 16:83962151-83962173 TAGGGTGGCCATGATGGGGCAGG - Intronic
1141511430 16:84514566-84514588 TGGGATGAAAATAATGGGGGTGG + Intronic
1142027839 16:87824019-87824041 AAGGCTGCCCAGAATGGGGTAGG + Intergenic
1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG + Intronic
1146241690 17:31234782-31234804 AAGGATTACAATAATGTGGTAGG - Intronic
1149205749 17:54244595-54244617 TAAAATGAACATAATGGGGAGGG + Intergenic
1160441675 18:78898219-78898241 AATGATGACCATCATGGGGGTGG + Intergenic
1160441826 18:78898985-78899007 GACGATGACCATCATGGGGGTGG + Intergenic
1164023222 19:21327585-21327607 TAAGGTGAGCAGAATGGGGTGGG - Intronic
1165522843 19:36328172-36328194 TGGGATGACCCTAAGGGAGTAGG + Intergenic
1167126100 19:47549726-47549748 CAGCATGACCACAATGGGCTGGG + Intronic
1168163034 19:54525150-54525172 AAGGATGAACATAATGCGTTGGG + Intergenic
926722769 2:15973889-15973911 TAGGAACACCAAAAAGGGGTGGG - Intergenic
926957716 2:18319717-18319739 TAGAGTGACCATGATGGGCTAGG + Intronic
930996234 2:57721893-57721915 TAAGATGACAAAAATGGGATAGG - Intergenic
931801226 2:65760124-65760146 TAGGATGACATTAATGAAGTTGG + Intergenic
931965501 2:67529216-67529238 CAGGATGTCTATAATGGGGGAGG + Intergenic
934976454 2:98806087-98806109 TAGTATATCCATCATGGGGTGGG + Intronic
935599378 2:104907088-104907110 TAGGATGACGATGAGGGGCTGGG - Intergenic
938263181 2:129909584-129909606 TGGGAGGACCCTCATGGGGTGGG - Intergenic
940881006 2:158946829-158946851 TAAAATCACCATAATGGGGCTGG - Intergenic
947021546 2:225683012-225683034 TAGGAAGAACAGAATGGGGGGGG - Intergenic
947606032 2:231486228-231486250 TAGAATGAACATTATGGTGTTGG + Intergenic
1170417042 20:16155675-16155697 GAGGATGTTCATAATGGGGGAGG + Intergenic
1171219083 20:23377917-23377939 TAGGATGAAAATGATGTGGTAGG + Intronic
1177479807 21:21671603-21671625 TAAGATAACCAAATTGGGGTGGG + Intergenic
1181000507 22:19985901-19985923 TGGGAGGGCCATAATGGGGATGG - Intronic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
954055767 3:48023047-48023069 TAGGATGACGATAATGCACTAGG + Intronic
955572026 3:60318086-60318108 TAAGATGCCCAGAATGGGGCGGG - Intronic
956204076 3:66738127-66738149 TAGGATGGCCAGAAAGGGGATGG + Intergenic
958889974 3:99772514-99772536 CAGGATGTTCATAATGGGGGAGG + Intronic
959874189 3:111362474-111362496 TAATTTGACCAGAATGGGGTTGG - Intronic
967310298 3:188099801-188099823 TAGGAAGAACATTATGGGTTGGG + Intergenic
971265528 4:25093461-25093483 TGGGATTACCATGATGGGCTAGG + Intergenic
972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
981096779 4:140790055-140790077 AAGCATGACAATAATGGGGAGGG + Intergenic
983648563 4:170016493-170016515 TAGGTAGAGCATGATGGGGTGGG - Intronic
984167693 4:176321471-176321493 TAGTATCCCCTTAATGGGGTAGG + Intronic
988599967 5:32630804-32630826 TAGGGTGACCATTATGTGATAGG + Intergenic
999720591 5:154396467-154396489 GAGGAAGACCATGATAGGGTGGG + Intronic
1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG + Intergenic
1008908179 6:56703643-56703665 GAGGATGAGGATAAGGGGGTAGG - Intronic
1012365566 6:98435231-98435253 TAGTATGACCATAGCGTGGTGGG - Intergenic
1016295510 6:142569182-142569204 AAGGAAGACTATAATGTGGTTGG - Intergenic
1019907219 7:4073947-4073969 TAGGCTGAGCACTATGGGGTGGG + Intronic
1037649809 8:20826051-20826073 TAGGATAACCAGAATGTTGTGGG - Intergenic
1042804547 8:72757311-72757333 TTAGCTGACCACAATGGGGTTGG + Intronic
1044631976 8:94289044-94289066 TTGGAGTACCTTAATGGGGTTGG - Intergenic
1045924784 8:107571334-107571356 TAGGAAGAACATCACGGGGTGGG - Intergenic
1046901843 8:119532041-119532063 TAGGATGATTATAATTAGGTAGG - Intergenic
1050211758 9:3267278-3267300 TAGGTTCTCTATAATGGGGTAGG + Intronic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1055781512 9:79826278-79826300 GAGGATGCTCATAATGGGGGAGG + Intergenic
1059603904 9:115812391-115812413 TAGGTACACCATAATGAGGTAGG + Intergenic
1060701355 9:125751843-125751865 TAAGATGACCAAAAAGAGGTGGG - Intronic
1187385374 X:18843774-18843796 AAGGATGAGTATAATAGGGTTGG + Intergenic
1188502194 X:30839650-30839672 TAGGATGCTGATAATGGGGCAGG + Intronic
1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG + Intergenic
1195931913 X:110086871-110086893 GAGGAATACCATAATGGGGATGG + Intronic