ID: 976409742

View in Genome Browser
Species Human (GRCh38)
Location 4:84699745-84699767
Sequence TCATCCTAGTAAATATGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 0, 2: 29, 3: 141, 4: 611}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976409734_976409742 -5 Left 976409734 4:84699727-84699749 CCCCCCACCCCATTATGGTCATC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409730_976409742 18 Left 976409730 4:84699704-84699726 CCAGCCCTTGTTGTTTTTCAGTT 0: 1
1: 0
2: 4
3: 55
4: 666
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409729_976409742 24 Left 976409729 4:84699698-84699720 CCTTTGCCAGCCCTTGTTGTTTT 0: 1
1: 0
2: 3
3: 44
4: 573
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409736_976409742 -7 Left 976409736 4:84699729-84699751 CCCCACCCCATTATGGTCATCCT 0: 1
1: 0
2: 0
3: 7
4: 133
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409738_976409742 -9 Left 976409738 4:84699731-84699753 CCACCCCATTATGGTCATCCTAG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409732_976409742 13 Left 976409732 4:84699709-84699731 CCTTGTTGTTTTTCAGTTCCCCC 0: 1
1: 0
2: 1
3: 17
4: 315
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409731_976409742 14 Left 976409731 4:84699708-84699730 CCCTTGTTGTTTTTCAGTTCCCC 0: 1
1: 0
2: 5
3: 33
4: 343
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409735_976409742 -6 Left 976409735 4:84699728-84699750 CCCCCACCCCATTATGGTCATCC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611
976409737_976409742 -8 Left 976409737 4:84699730-84699752 CCCACCCCATTATGGTCATCCTA 0: 1
1: 0
2: 1
3: 2
4: 101
Right 976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG 0: 1
1: 0
2: 29
3: 141
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976409742 Original CRISPR TCATCCTAGTAAATATGAAG TGG Intronic
900664073 1:3801954-3801976 TGATCCTAGTTAATATAAAGGGG - Intergenic
901162421 1:7188994-7189016 CCATGCTAGTAAGTGTGAAGTGG + Intronic
901378005 1:8853612-8853634 CCATCCTAGTAGGAATGAAGTGG - Intergenic
901682666 1:10923416-10923438 TCATCCTAGTGAATATGAAATGG + Intergenic
902133440 1:14283543-14283565 CCATCCTAGTGAGTGTGAAGTGG - Intergenic
902871446 1:19315935-19315957 TCTTCCCAGCAACTATGAAGTGG - Intronic
903627375 1:24741168-24741190 TGATCCTATTAAATATTAATAGG + Intergenic
904636847 1:31888584-31888606 CCATCCTAGTGGGTATGAAGTGG + Intergenic
904776391 1:32910430-32910452 CCATGCTAGTGAATATGAAGTGG - Intergenic
905676864 1:39832358-39832380 GCCTCCTTGTTAATATGAAGGGG - Intergenic
906466345 1:46083733-46083755 TCATCCTAGTGGGTGTGAAGTGG - Intronic
907538463 1:55188629-55188651 CCATCCTAGTAGGTGTGAAGTGG - Intronic
908172432 1:61519236-61519258 TCATCCTAGTCAGTGTGAAGTGG + Intergenic
909194490 1:72600216-72600238 CCATCCTAGTGAGTATGAAATGG + Intergenic
909371015 1:74883515-74883537 GCATCATAGTAAATATGAAAAGG + Intergenic
909887065 1:80955353-80955375 TCATCATAGTGGATATGAAGTGG - Intergenic
910289373 1:85585383-85585405 TCATCCTAGTAAATATAATGAGG + Intergenic
910314020 1:85861164-85861186 CCATCCTAGTAGGTATGAAGTGG + Intronic
910420917 1:87061964-87061986 CCATCCTAGTGTGTATGAAGTGG + Intronic
910607390 1:89101640-89101662 TCTTCCTATTAAACATGCAGGGG - Intergenic
910712604 1:90197180-90197202 TCTTCCTAGTAATTCTGAATCGG + Intergenic
910795787 1:91096217-91096239 TCAGCCTAGTAGATGTGAATTGG + Intergenic
910941540 1:92540370-92540392 CCATCCTAGTAAGTGTGAAGTGG + Intronic
911269994 1:95789620-95789642 TCATCCTATGAGCTATGAAGGGG - Intergenic
913267358 1:117058283-117058305 TCAATCTTGTAAATATGATGAGG + Intergenic
913301913 1:117380168-117380190 CCATCCTAGTGTCTATGAAGTGG + Intronic
913309217 1:117469776-117469798 TCTTCCTAGTAGCTGTGAAGTGG - Intronic
913991431 1:143616258-143616280 TCATACTAGTAGGTGTGAAGTGG + Intergenic
914794470 1:150908447-150908469 TCATCCTAGTGGGTGTGAAGTGG + Intergenic
915613132 1:157011782-157011804 TCATCCTAGTAGATGTAAAATGG - Intronic
915992417 1:160531145-160531167 TTATCCTAATGAATGTGAAGTGG + Intergenic
916386331 1:164275282-164275304 TCATCCTATTAGGTATCAAGTGG - Intergenic
916493322 1:165322129-165322151 CCATCCTAGTAGGTATAAAGTGG - Intronic
916532589 1:165671899-165671921 TCATCCTATTGGGTATGAAGTGG - Intronic
916775409 1:167957822-167957844 TCATCCTAGTGGATGTGAAGTGG + Intronic
917304431 1:173612525-173612547 CCATCCTAGTGGGTATGAAGTGG - Intronic
917531275 1:175837469-175837491 TTTTGCTAATAAATATGAAGTGG + Intergenic
918273398 1:182925493-182925515 TGATCCTAGCGAATGTGAAGTGG - Intronic
918593599 1:186267608-186267630 TCATCCTAGTGGATGTGAAGTGG - Intergenic
918637420 1:186794959-186794981 TCATCCTATTGAATATGAAGTGG + Intergenic
918958599 1:191241018-191241040 TCATCCTAGTGGGTATGAAATGG - Intergenic
918965993 1:191349197-191349219 ACATCCTAGTTGATGTGAAGTGG - Intergenic
919314687 1:195956128-195956150 TCAGCCTACTCAATGTGAAGAGG - Intergenic
921197608 1:212774639-212774661 TCAACCTAGTAGGTATAAAGTGG - Intronic
921404764 1:214766336-214766358 TCATCCTTGTAGGTGTGAAGTGG + Intergenic
921597029 1:217065605-217065627 TCAGTCTTGTAAATATGAAGTGG - Intronic
921725435 1:218518059-218518081 CCTTCCAAGGAAATATGAAGAGG + Intergenic
922288332 1:224188538-224188560 TCATCCTAGTGAGTGTGAGGTGG + Intronic
922630641 1:227106129-227106151 CTATCCCAGTACATATGAAGTGG + Intronic
922646988 1:227297241-227297263 TCATTTTAGTAGGTATGAAGTGG - Intronic
922931125 1:229390571-229390593 TCATCCCAGTACAGGTGAAGAGG + Intergenic
923011310 1:230090081-230090103 CCATCCTAATGGATATGAAGTGG + Intronic
923476711 1:234340511-234340533 CCATCCTAGTAAATATGAATTGG - Intergenic
923968457 1:239171473-239171495 ACAGCCTAATAAGTATGAAGTGG - Intergenic
924115381 1:240740362-240740384 TCAGTCTTGTAAATGTGAAGTGG + Intergenic
924671617 1:246132936-246132958 CCATCCTAGTGAATGTGAAGTGG - Intronic
924746261 1:246836301-246836323 TCATCCTAGCTGATGTGAAGTGG - Intergenic
1063107447 10:3004858-3004880 CCATTCTAATAAATCTGAAGTGG + Intergenic
1064213275 10:13378701-13378723 TCATCCTAGTGGGTATGAAGTGG - Intergenic
1064219622 10:13429571-13429593 CCATCCTAGTGAGTGTGAAGTGG - Intergenic
1064498762 10:15945114-15945136 TCATCCTAGTAGATGTGAGGTGG + Intergenic
1064778061 10:18802086-18802108 CTATCCTAGTAGATGTGAAGTGG + Intergenic
1064818972 10:19302063-19302085 CCATCCTAGTGGATGTGAAGTGG - Intronic
1065473156 10:26103879-26103901 TGATTCTAGTGAATGTGAAGTGG + Intronic
1065500161 10:26373224-26373246 CCATCTTAGTACATGTGAAGTGG + Intergenic
1066027788 10:31381597-31381619 TCGTCCTACTAAATATCAAAAGG + Intronic
1066133123 10:32413996-32414018 GTATCCTAGAAGATATGAAGTGG - Intergenic
1066172428 10:32864195-32864217 CCATCCTAATGACTATGAAGTGG - Intronic
1066314062 10:34226221-34226243 CCATCCTAGTGAGTGTGAAGTGG - Intronic
1066346663 10:34593491-34593513 TCATCCTAGTTAATCTAAATAGG - Intronic
1067674376 10:48358355-48358377 TCATCATAGTGGATATGAAGTGG + Intronic
1067813281 10:49448227-49448249 TCATGCTAGTGACTGTGAAGTGG + Intergenic
1068353131 10:55876024-55876046 CCATTCTATTAAGTATGAAGTGG + Intergenic
1068397399 10:56481614-56481636 ACATCTTAGTGGATATGAAGTGG - Intergenic
1068652245 10:59535259-59535281 CCATCCTAGTGAGTATGTAGTGG - Intergenic
1069378108 10:67814813-67814835 CCATCCTAGTAGGTATAAAGTGG - Intronic
1069647368 10:70011725-70011747 GCATCCTAATGAATATGAGGTGG - Intergenic
1070500186 10:77065398-77065420 ACTTCCTAGAGAATATGAAGTGG + Intronic
1070576734 10:77684867-77684889 TCATCCTAGAGACTGTGAAGTGG - Intergenic
1070714022 10:78704889-78704911 CCATACTAGTGGATATGAAGTGG - Intergenic
1071133476 10:82424338-82424360 TCATCCTATTGGATGTGAAGTGG + Intronic
1071144600 10:82553345-82553367 CCATCTTAGAAAACATGAAGTGG - Intronic
1071506630 10:86236079-86236101 TCATCCTAGTGGGTGTGAAGTGG + Intronic
1072176749 10:92931741-92931763 TCATTCTAGTAAGTATGCAGTGG - Intronic
1072643392 10:97232007-97232029 TCATCCTAGTGGGTGTGAAGTGG + Intronic
1072837704 10:98734545-98734567 CCATCCTAGTAAGTGTGAAGTGG + Intronic
1072996705 10:100251409-100251431 CCATCCTAGTGGGTATGAAGTGG + Intronic
1073316569 10:102585457-102585479 ACATTCTAGTGGATATGAAGTGG + Intronic
1073807600 10:107116069-107116091 CCATCCTACTATGTATGAAGTGG - Intronic
1073809555 10:107137459-107137481 ACATTCTAGTACATATGGAGGGG - Intronic
1074091088 10:110256704-110256726 TCATCTTAGTAACTGTGAAGTGG - Intronic
1074129554 10:110561488-110561510 CCATCCTAGTGGGTATGAAGTGG + Intergenic
1074146768 10:110723612-110723634 CCATTCTAGTGGATATGAAGGGG + Intronic
1074474755 10:113760499-113760521 CCATCCTAGTGAGCATGAAGTGG + Intronic
1074486107 10:113882390-113882412 CCATCCTACTGGATATGAAGTGG + Intronic
1074844130 10:117381924-117381946 TCAGCCTAGTAGGTATAAAGTGG + Intergenic
1075139316 10:119817528-119817550 TCATCCTACTTAGTGTGAAGTGG + Intronic
1075454229 10:122574550-122574572 TCATCATAGGAAAGAGGAAGAGG - Intronic
1075501336 10:122977712-122977734 TCATTCTAGTAAGTGTGTAGTGG - Intronic
1075696056 10:124436324-124436346 CCATCCTAGTAGATAGGAAGTGG - Intergenic
1075912569 10:126138087-126138109 CCATCCTAGTGGATATAAAGTGG + Intronic
1077706725 11:4493742-4493764 TGATCCTAGTTAATAAAAAGGGG - Intergenic
1078075163 11:8152054-8152076 CCATCCTAGTTAGTGTGAAGTGG - Intronic
1078128211 11:8588972-8588994 CCATCCTAGTATGTGTGAAGTGG - Intronic
1078232373 11:9455127-9455149 TCATACTAGTAGGTGTGAAGTGG - Intergenic
1078515869 11:12022067-12022089 CCATCCTAATAAGTATGAAGTGG - Intergenic
1078589299 11:12625405-12625427 CCATCCTAGTGGATGTGAAGTGG - Intergenic
1078636449 11:13054753-13054775 GCAACCCAGTAAAGATGAAGAGG - Intergenic
1078637722 11:13067437-13067459 TCATCCTAGTGGGTGTGAAGTGG - Intergenic
1078791260 11:14544630-14544652 CCATCTTAGTAAGTATAAAGTGG - Intronic
1078948996 11:16107038-16107060 TCATCCCAGTAGGTGTGAAGTGG - Intronic
1080510207 11:32962180-32962202 TCATCCTAGCAAGTGTGAAGTGG + Intronic
1080589775 11:33711811-33711833 CCATCCTAGTGAGTATAAAGTGG - Intronic
1080618319 11:33965191-33965213 TCATCCTAGTGGATATGAAGGGG - Intergenic
1080899514 11:36475135-36475157 CCATTCTAGTAAATGTGAAATGG - Intergenic
1081045458 11:38268644-38268666 TAATCTAAATAAATATGAAGAGG - Intergenic
1081412392 11:42775198-42775220 ACATCCTGGTAAATAAGCAGAGG + Intergenic
1081841704 11:46206701-46206723 CCATCCTAGTGGGTATGAAGTGG - Intergenic
1082836978 11:57658261-57658283 TCATCCTAGTCAACAGGAAAGGG - Intronic
1084637637 11:70402994-70403016 TCATCCTAGTGGGTATGAGGTGG + Intronic
1084993335 11:72950065-72950087 TCATCCTAGCGGATGTGAAGTGG + Intronic
1085131556 11:74043666-74043688 TCACCCTAGTGGATATAAAGTGG + Intronic
1085152037 11:74260093-74260115 CCATCCTAGGAAGTGTGAAGTGG + Intronic
1085188320 11:74595320-74595342 CCATCCTAGTGGATGTGAAGTGG + Intronic
1085285392 11:75356649-75356671 TCATCCAAGTATCAATGAAGAGG + Intergenic
1085343259 11:75747788-75747810 CCATCCTAGTGGGTATGAAGTGG - Intergenic
1085552698 11:77389546-77389568 CCATCCTAGTGAGTGTGAAGTGG + Intronic
1086859952 11:91914433-91914455 TCATCCTAGTGAATGCGAAGTGG - Intergenic
1088038897 11:105352367-105352389 ATATCCTAGTAGGTATGAAGTGG - Intergenic
1088133012 11:106518580-106518602 CCATTCTAGTAAGTATGTAGTGG - Intergenic
1088316236 11:108509622-108509644 TCATCCTCATAGATATTAAGCGG + Exonic
1088874350 11:113921442-113921464 TTATCTTAATAAATACGAAGGGG - Intronic
1089162384 11:116449020-116449042 TCATTCTAATAGATATGAAGTGG - Intergenic
1089424253 11:118358308-118358330 CCATCCTAGTAGGTATTAAGTGG + Intergenic
1089506147 11:118963491-118963513 CCATCCTATGAAGTATGAAGTGG + Intergenic
1090056155 11:123426766-123426788 ACATCCAAGTAAATGTGAACTGG - Intergenic
1090311765 11:125747404-125747426 TTTTCCTGGTAAGTATGAAGAGG + Exonic
1090364581 11:126195257-126195279 CCATCCTAGTGGATGTGAAGTGG - Intergenic
1090533678 11:127617424-127617446 CTATTCTAGTGAATATGAAGTGG + Intergenic
1090707017 11:129347135-129347157 TCATCCTAGTGAGTATGAAGTGG - Intergenic
1090813806 11:130272307-130272329 TCATCCTAGTGGATGTGAAGTGG + Intronic
1091043915 11:132308723-132308745 TGAACCCAGTCAATATGAAGCGG + Intronic
1091070798 11:132561174-132561196 TCATCATAGTGAAGATGAAGTGG - Intronic
1091210742 11:133856158-133856180 CCATCCTAGTGAGTGTGAAGTGG + Intergenic
1091314721 11:134605745-134605767 TCATTCTAATAAATGTGTAGTGG + Intergenic
1091342991 11:134834320-134834342 TCATCCTAGTGAGTCTGAAGTGG - Intergenic
1091752000 12:3028489-3028511 CCATCCTAGCAAATGTGAAGTGG + Intronic
1092012131 12:5123009-5123031 TCATCCTAGAAAATGTGGATGGG - Intergenic
1092773551 12:11920546-11920568 TCATTCTAATAAGTATGTAGTGG + Intergenic
1093009191 12:14086411-14086433 CCATTCTAGTGAGTATGAAGTGG + Intergenic
1093470033 12:19490827-19490849 TCATCCTAGTGAGTGTGAAGTGG - Intronic
1093665524 12:21808326-21808348 TCATCTTAGTAAAGATGACCAGG - Intronic
1093825164 12:23675944-23675966 CCATCCTAATAGATATGACGTGG - Intronic
1095256563 12:40043799-40043821 TCATCCTAGTGGGTGTGAAGTGG - Intronic
1095546841 12:43381925-43381947 CCATCCTAGTATGTATGAAATGG - Intronic
1095840993 12:46692717-46692739 TCATCCTAATGGATGTGAAGTGG - Intergenic
1096161454 12:49381084-49381106 CTATCCTAGTAGATGTGAAGTGG + Intronic
1096293089 12:50359080-50359102 CCATCCTAGTACCTGTGAAGTGG - Intronic
1096577615 12:52563412-52563434 TCATCCTAGTGAGTATAAACTGG + Intergenic
1096671786 12:53203717-53203739 TCATTCTAGTAGAAGTGAAGTGG - Intronic
1097100648 12:56586444-56586466 CCATCCTAATAGGTATGAAGTGG + Intronic
1097296781 12:57973964-57973986 CCATCCTAGTAAGTATGAGGTGG - Intergenic
1098613405 12:72490282-72490304 TCATCCTAGCAGGTATGCAGTGG - Intronic
1098771100 12:74553932-74553954 CTATCCTAGTGAGTATGAAGTGG - Intergenic
1098785954 12:74755973-74755995 TCATTCTAGTGAAAGTGAAGTGG + Intergenic
1099236464 12:80088189-80088211 CCATCCTAGCGGATATGAAGTGG + Intergenic
1100384922 12:94097081-94097103 CCATCCTAGTGTATATGAAATGG - Intergenic
1100441787 12:94624085-94624107 CCATCCTAGTAAGTATGAAGTGG - Intronic
1100666660 12:96761154-96761176 CCATGCTAGTAGGTATGAAGTGG + Intronic
1100672354 12:96830398-96830420 TCATCCTAGTGGGTGTGAAGTGG + Intronic
1100770621 12:97918286-97918308 TCCTCCTAGTGGGTATGAAGTGG + Intergenic
1100850127 12:98701535-98701557 CCATCCTAGTAGGTGTGAAGTGG + Intronic
1101738642 12:107482593-107482615 TCCTTCTAGTAAATATGCATGGG + Intronic
1102365791 12:112333386-112333408 TCATCCTAGTGGGTGTGAAGTGG + Intronic
1102449899 12:113033722-113033744 TCATCCTAATGGGTATGAAGTGG - Intergenic
1103630756 12:122258657-122258679 TCATCCTACTGAGTATGAAGTGG - Intronic
1103861570 12:124018897-124018919 TAATCATAGTAAATGTGAACTGG + Intronic
1104083061 12:125448858-125448880 CCATCCTAGTAAGTATATAGGGG + Intronic
1104584877 12:130039913-130039935 TCATCCTAGGAGATGTGAAGTGG - Intergenic
1105373883 13:19825720-19825742 TCATCCTCTTGGATATGAAGTGG - Intronic
1105869267 13:24489651-24489673 CCATCTTAGTAAATGTGAAGTGG + Intronic
1105946437 13:25194234-25194256 CCATTCTAATAAATATGTAGTGG - Intergenic
1106515921 13:30453749-30453771 CCATCCTAGTAGGTGTGAAGTGG - Intergenic
1106985381 13:35341678-35341700 CCATTCTAATGAATATGAAGTGG - Intronic
1107002446 13:35565128-35565150 TCATCCCAGTAAATGCAAAGTGG + Intronic
1107132011 13:36906702-36906724 CCATCCTAGTGGGTATGAAGTGG - Intronic
1107146694 13:37068086-37068108 TTATCCTAATGAATATGAAGTGG - Intergenic
1107233690 13:38142626-38142648 TCAGCCTACTCAATGTGAAGAGG + Intergenic
1107331129 13:39301988-39302010 TTATTCTATTAAGTATGAAGTGG - Intergenic
1107360363 13:39611109-39611131 TTATCCTAGTAAATCCCAAGTGG + Intergenic
1107437930 13:40397661-40397683 CCATCCTAGTAGGTATTAAGTGG - Intergenic
1107580552 13:41779655-41779677 TCATCTTAGTGAAAAGGAAGAGG - Intronic
1107713617 13:43175318-43175340 CCATCCTAGTGGATGTGAAGTGG + Intergenic
1107899016 13:44993835-44993857 TCATCCTAATGAGTGTGAAGTGG + Intronic
1108365562 13:49708327-49708349 CAATCCTAGTAGATGTGAAGTGG - Intronic
1108452481 13:50581175-50581197 TCATCCTAGTGGGTGTGAAGTGG + Intronic
1108882512 13:55137852-55137874 AGATCATAGGAAATATGAAGAGG - Intergenic
1109117931 13:58413199-58413221 TCATCCTAGTAGTTGTGAAGTGG - Intergenic
1109128576 13:58550435-58550457 TCATCCTAGTATATATTTGGAGG + Intergenic
1109684249 13:65792840-65792862 CCTTACTAGTAAGTATGAAGTGG - Intergenic
1109969358 13:69745278-69745300 ACATCCAATTAAAAATGAAGAGG - Intronic
1110273088 13:73613371-73613393 TCATTCTAATAGATATGTAGAGG + Intergenic
1112212353 13:97390959-97390981 TCACCGTAGCAAATATGAATTGG + Intronic
1113040721 13:106101304-106101326 TCATAAAAGTAAATTTGAAGAGG - Intergenic
1113246060 13:108396930-108396952 CCATCCTAGTGGGTATGAAGTGG - Intergenic
1114947554 14:27703679-27703701 CCATGCTAGTACCTATGAAGTGG + Intergenic
1115045482 14:28987607-28987629 ACATCCTAGTGTATCTGAAGTGG - Intergenic
1115319890 14:32068524-32068546 CCATTCTAGTGGATATGAAGTGG - Intergenic
1115625423 14:35187342-35187364 TCATCCTAGCAGGTGTGAAGTGG + Intronic
1115860099 14:37675769-37675791 CCATCCTAGTGAGTATAAAGTGG + Intronic
1117515548 14:56497266-56497288 CCATCCTAGTAGATATTAACTGG + Intronic
1117525674 14:56600633-56600655 CCATCCTAGTCAGTGTGAAGTGG - Intronic
1118244588 14:64097267-64097289 TCTTCCTACTAAATAGGAATAGG - Intronic
1118680651 14:68238206-68238228 CCATCCTAGTAGTTGTGAAGTGG + Intronic
1118805453 14:69232582-69232604 CCATCCTAGTAGGTGTGAAGCGG + Intronic
1118876475 14:69789017-69789039 CCATGCTAGTAGATATAAAGTGG - Intronic
1119283904 14:73435118-73435140 TCATTCTAGTGAGTATAAAGTGG - Intronic
1120000692 14:79300025-79300047 TCACCCTAGTAACTATAATGAGG + Intronic
1120606769 14:86588415-86588437 ACATCCTAGTGAGTATGAAGTGG - Intergenic
1120740109 14:88099056-88099078 CCATCCTAGTAGGTGTGAAGTGG - Intergenic
1121069795 14:91007729-91007751 CCATCCTAGTAGATATGAGGTGG + Intronic
1122095534 14:99368090-99368112 TCATCCTAGTAGGTGTGAAGTGG + Intergenic
1122150007 14:99720424-99720446 CCATCCTAATGAGTATGAAGTGG + Intronic
1122185336 14:99988357-99988379 CCATCCTAGTGAGTATGAAATGG - Intronic
1124059718 15:26278801-26278823 TTATCTTAGTAAGTGTGAAGTGG + Intergenic
1124129721 15:26972732-26972754 AAATCCTACTAAACATGAAGGGG + Intronic
1124178082 15:27445370-27445392 CCATCCTGGTAAGTGTGAAGTGG + Intronic
1124596331 15:31094667-31094689 TCATCCTAGTAGGAATGAAGTGG - Intronic
1124916597 15:33981203-33981225 TTTTCCTAAAAAATATGAAGCGG + Intronic
1124931869 15:34127960-34127982 TCATCCTAGTGGGTGTGAAGTGG + Intergenic
1125554810 15:40575341-40575363 TCATCCTAGTAGGAGTGAAGTGG + Intergenic
1125582504 15:40796552-40796574 CCATCCTAATAAGTGTGAAGTGG - Intronic
1125638767 15:41212093-41212115 CCATCCTAGTGGGTATGAAGTGG - Intronic
1126202923 15:46008173-46008195 CCATCCTAGTTCATGTGAAGTGG + Intergenic
1126737442 15:51745906-51745928 CCATCCTAGTTAATATGCAGTGG - Intronic
1126934484 15:53690990-53691012 GTATCCTAGTGAATATGAAATGG + Intronic
1127074558 15:55312584-55312606 TCATCCTAGTGAACATGAAATGG + Intronic
1127429934 15:58895039-58895061 CCATCTTAGTAAATATTCAGGGG + Intronic
1128048971 15:64645834-64645856 CCATCCTAGTAGGTATGAAGTGG - Intronic
1128395965 15:67226055-67226077 CCATCCTAGTAAGTGTGAAGTGG + Intronic
1128424837 15:67531228-67531250 TCATCCTAGTGGATATGAAGTGG - Intergenic
1128658479 15:69480100-69480122 CCATCCTAGTGAGTATGAAGTGG - Intergenic
1128880594 15:71238975-71238997 CCATCCTAGTGAACATGAAATGG + Intronic
1129121826 15:73402305-73402327 CCATCCTAGTGGCTATGAAGTGG + Intergenic
1129355786 15:74990392-74990414 TAATCCTAGTACATATAGAGTGG + Intronic
1129526521 15:76219783-76219805 TCATCCTAGTAGGTGTGAAGTGG - Intronic
1129647769 15:77453383-77453405 CCATCCTAGTAGATGTGAAGTGG - Intronic
1129849806 15:78786915-78786937 TCAGCCTACTCAACATGAAGAGG + Intronic
1130008565 15:80127663-80127685 CCATCCTAGTGGATACGAAGTGG - Intronic
1130315548 15:82792304-82792326 TCATCCTAGTGGTTATGAAATGG + Intronic
1130422194 15:83758570-83758592 TCATCCTAATGGGTATGAAGTGG + Intronic
1130431931 15:83857013-83857035 TCATCCTAATAGGTGTGAAGTGG + Intronic
1130816333 15:87439036-87439058 CCATCCTAGTGGGTATGAAGTGG - Intergenic
1130869588 15:87959981-87960003 GCATCCTACTAAAAAAGAAGTGG + Intronic
1131920482 15:97322475-97322497 TCATCCTAATGGGTATGAAGTGG + Intergenic
1132210444 15:100017854-100017876 TCATGCTAGTAGGTGTGAAGTGG + Intronic
1133255905 16:4515713-4515735 CCATCCTAGTAGATAGGAAATGG - Intronic
1133332611 16:4984728-4984750 TCATCCTAGTGGATGTGAAGTGG + Intronic
1134421024 16:14089825-14089847 CCATCCTAATGAATGTGAAGTGG + Intronic
1134901835 16:17945115-17945137 TCATCCTAGTGAGTGTAAAGAGG - Intergenic
1135127203 16:19821018-19821040 CCATCCTAGTAGATATGAAGTGG - Intronic
1135242716 16:20823072-20823094 CCATCCTAGTGGGTATGAAGTGG + Intronic
1135290425 16:21232656-21232678 TCATCCTAGTGGATATGAAGTGG - Intergenic
1137313290 16:47287722-47287744 CCATCCTAGTGAGTGTGAAGTGG + Intronic
1137317609 16:47343655-47343677 CCTTCCTAGTAGATGTGAAGTGG - Intronic
1137390517 16:48077416-48077438 CCATCCTAATAAGTGTGAAGTGG - Intergenic
1138979503 16:62250114-62250136 TCAGCCTAATAAATCTGAAAAGG + Intergenic
1139695857 16:68674221-68674243 CCATCCTAGTGCATGTGAAGTGG + Intronic
1140117194 16:72052598-72052620 CCATCCTAGTAGGTGTGAAGTGG + Intronic
1140447354 16:75041280-75041302 TCATTCTAGTAGGTATGTAGTGG + Intronic
1141418422 16:83895386-83895408 CCATCCTAGTGGATGTGAAGTGG + Intergenic
1142502785 17:342163-342185 CCATCCTAGTGGATGTGAAGTGG - Intronic
1142824831 17:2502874-2502896 CCATCCTAGTGGGTATGAAGTGG - Intronic
1143161118 17:4872005-4872027 CCATCCTAGTAGGTGTGAAGTGG - Intronic
1143531377 17:7506406-7506428 TCATCCTAGTGCATGTGAAGTGG - Intronic
1143753188 17:9046345-9046367 CCATCCTAGTGAATGTAAAGTGG - Intronic
1144694532 17:17293286-17293308 TCCTCCTAGTAGGTGTGAAGTGG + Intergenic
1144856625 17:18272217-18272239 TCATCCTAGTGGGTATGAAGTGG - Intronic
1145095907 17:20025893-20025915 CCATCCTAGTGCATATGAAGTGG + Intronic
1145120272 17:20253062-20253084 TCTTCCTAATAAATGTGAGGTGG + Intronic
1145327803 17:21845417-21845439 CCATCCTTGTAGATGTGAAGTGG + Intergenic
1146030058 17:29358551-29358573 CCATTCTAGTGAATGTGAAGTGG + Intergenic
1146099080 17:29961149-29961171 CCATCTTAGTAAATGTGAAGTGG + Intronic
1146231255 17:31112474-31112496 CCATCCTAGTGGGTATGAAGTGG + Intronic
1146406188 17:32540598-32540620 TCATCCTAATCGATATGAAAAGG - Intronic
1147128336 17:38389106-38389128 CCATCCTAGTGAGTATGAAGTGG + Intronic
1147476456 17:40716143-40716165 CAATCCTAGTGAATATTAAGTGG - Intergenic
1147835196 17:43325139-43325161 TGATCCTAGTCAATAAAAAGTGG - Intergenic
1147836457 17:43335668-43335690 TGATCCTAGTCAATAAAAAGAGG - Intergenic
1147836908 17:43339417-43339439 TGATCCTAGTTAATAAAAAGCGG - Intergenic
1148256769 17:46140828-46140850 CCATGCTAGTCAATGTGAAGTGG - Intronic
1148661141 17:49333833-49333855 CCATCCTAGTAGGTGTGAAGTGG - Intronic
1150345385 17:64400693-64400715 TTATCCTAGTGGGTATGAAGTGG - Intronic
1150418795 17:65010451-65010473 TCAGTCTAGTAAACATGAGGAGG - Intergenic
1150744794 17:67807923-67807945 TCATGCTAGTGAATGTGAAGTGG + Intergenic
1150780595 17:68118313-68118335 TCAGAATAGCAAATATGAAGAGG + Intergenic
1151162288 17:72175766-72175788 TAATCCTATTAAATATGCACCGG + Intergenic
1203192437 17_KI270729v1_random:201629-201651 CCATCCTTGTAGATGTGAAGTGG + Intergenic
1203201802 17_KI270730v1_random:1066-1088 CCATCCTTGTAGATGTGAAGTGG + Intergenic
1153206559 18:2709567-2709589 CCATCCTAACAGATATGAAGTGG + Intronic
1153215817 18:2820145-2820167 ACATCCTAGTAGATGCGAAGTGG - Intergenic
1153385339 18:4487955-4487977 CCATTCTAGTAGGTATGAAGTGG - Intergenic
1153389561 18:4538968-4538990 TCATCTTTATAAATATGAATGGG - Intergenic
1154934253 18:21035081-21035103 TCATCCTAATGGATGTGAAGTGG - Intronic
1155098610 18:22585725-22585747 TCATACTAGTAAATATAAATGGG + Intergenic
1155764658 18:29613133-29613155 CCATCCTAGTAGCTATGAAGTGG - Intergenic
1155898530 18:31359658-31359680 GCATCCCAGTAAAGATGAAAGGG - Intergenic
1156411769 18:36835882-36835904 ACATCCTAGTGAGTGTGAAGTGG - Intronic
1156412749 18:36849884-36849906 CCATGCTAGTAGATATGCAGTGG + Intronic
1157033990 18:43949094-43949116 ACATCCTAGTAAATAAAAACAGG - Intergenic
1157253507 18:46116993-46117015 CCATCCTAGTGACTGTGAAGTGG - Intronic
1157510853 18:48272541-48272563 GCATTCTAGTAAATGTGAAGTGG - Intronic
1157681037 18:49607082-49607104 TCATCCTAGTGAGTACAAAGTGG - Intergenic
1157809157 18:50681096-50681118 CCATCCTAGTGGATGTGAAGTGG + Intronic
1158380553 18:56925448-56925470 TCATCCCAGTGGGTATGAAGTGG + Intronic
1158598269 18:58835338-58835360 TCACCCTAGTGGGTATGAAGTGG - Intergenic
1158756372 18:60330927-60330949 CCATCCTAGTGGGTATGAAGTGG + Intergenic
1159494109 18:69178312-69178334 TTATCCTAGTAAATGGAAAGTGG + Intergenic
1159577226 18:70194248-70194270 TCATCCTAGTAGATGTGAAGTGG - Intronic
1161900436 19:7114863-7114885 TCTTCTTAGTAAATTTGTAGTGG - Intronic
1163992049 19:21007899-21007921 TGATCCTAGTCAATAAAAAGGGG + Intergenic
1164470998 19:28532354-28532376 CCATCCTAGTAGATGTGAAGTGG - Intergenic
1164772742 19:30823853-30823875 CCATCCTAGTGAGCATGAAGTGG - Intergenic
1165642466 19:37401910-37401932 CCATTCTAGTAGATGTGAAGTGG + Intergenic
1168504718 19:56923638-56923660 GCGTCCTAGTAAATAAGACGGGG + Intergenic
925214265 2:2080633-2080655 CCACCCTAGTAAATATGAAGAGG - Intronic
925417817 2:3684275-3684297 TCATCCTAGTGGATGTGAGGTGG + Intronic
926004252 2:9360244-9360266 TGAGCCTAGTATATATAAAGTGG - Intronic
926190302 2:10722717-10722739 TCATCCTAGAAAGGATGAATTGG + Intronic
926613216 2:14968652-14968674 TCATCCTAGAGAGTGTGAAGTGG - Intergenic
926663640 2:15495744-15495766 TAATCCTAGTAGGTGTGAAGTGG - Intronic
927257385 2:21051583-21051605 CCATCCTAGTGGATGTGAAGTGG + Intergenic
927264470 2:21129400-21129422 TCATCCTAGTGTGTCTGAAGTGG + Intronic
927270388 2:21202710-21202732 GAATTCTAGTAAATATGAGGAGG - Intergenic
927780291 2:25933706-25933728 TCATCCTAGTGGATCTGAACTGG - Intronic
927953373 2:27189729-27189751 TTATCTTAGTAGGTATGAAGTGG - Intergenic
928050702 2:27992044-27992066 CCATCCTAGTGGGTATGAAGTGG + Intronic
928287337 2:30004323-30004345 CCATCTTACTAAGTATGAAGTGG - Intergenic
928507912 2:31972957-31972979 CCATCCTAGTAGGTATGAAGTGG - Intronic
928601369 2:32907034-32907056 GCATCCTAGTGAGTGTGAAGTGG - Intergenic
929181165 2:39041030-39041052 CCATCTTAGTAGATGTGAAGTGG + Intronic
929392240 2:41483348-41483370 GTTTCCTGGTAAATATGAAGGGG - Intergenic
929713551 2:44288684-44288706 TCACCCTAGTGGGTATGAAGTGG + Intronic
929716011 2:44310346-44310368 TCATCATAGTACAAATGAAGTGG + Intronic
930256234 2:49095919-49095941 TCATCCTAGTGAATGTAAAGTGG - Intronic
930662975 2:54073835-54073857 CCATTCTAGTAGGTATGAAGTGG - Intronic
930700127 2:54451392-54451414 CCATCCTAGTGAATGTGAAGTGG + Intergenic
931260985 2:60619148-60619170 CCATACTAGTAAGTATGAAATGG + Intergenic
931326416 2:61230115-61230137 CCATCCTAGAAGGTATGAAGTGG - Intronic
931461729 2:62455892-62455914 CCATCCTAGTGAGTATGAAGTGG + Intergenic
931704426 2:64935575-64935597 CCATCCTAGTAGATATGAAGTGG - Intergenic
931735799 2:65192740-65192762 CTATCCTAGTAAGTGTGAAGTGG - Intergenic
931854542 2:66288176-66288198 CCATCCTAGTGGGTATGAAGTGG + Intergenic
932169494 2:69540559-69540581 CCATCCTAGTGGGTATGAAGTGG - Intronic
932499081 2:72165874-72165896 TCATCCTAGTGGGTGTGAAGAGG - Intergenic
932900881 2:75698605-75698627 GCATCCTAGCAAATTTAAAGGGG + Intronic
933643599 2:84790685-84790707 TCATCCTAGTAGGTGTGAAGTGG - Intronic
933677649 2:85071216-85071238 TCGTACTAGTAAATATGCAGTGG + Intergenic
935241528 2:101182520-101182542 CCATCATAGTCAATGTGAAGTGG + Intronic
935467746 2:103419039-103419061 CCATCCTAGTTTGTATGAAGTGG + Intergenic
935479692 2:103570775-103570797 TCATTCTAGTGGATAAGAAGTGG - Intergenic
935621418 2:105133378-105133400 TCATCCTTGTAGGCATGAAGTGG - Intergenic
936000647 2:108825945-108825967 TCATCTCAGTGAGTATGAAGTGG + Intronic
936398144 2:112145132-112145154 TCATTCTAGTAAGCATGCAGTGG + Intronic
937226103 2:120370027-120370049 TCATCCTAGTGGGTATGCAGTGG + Intergenic
937351162 2:121163108-121163130 TCATTCTAATAGGTATGAAGTGG + Intergenic
937480664 2:122255292-122255314 TCTTCCTATTAAATTTGCAGGGG - Intergenic
937528397 2:122799007-122799029 TCACCCTACTCAATGTGAAGAGG + Intergenic
937582896 2:123510792-123510814 CCATTCTAGTAAGCATGAAGTGG - Intergenic
938325777 2:130399509-130399531 CCATCCCAGTGAATATGAAGTGG - Intergenic
938423179 2:131160686-131160708 CCATCCCAGTGAATATGAAGTGG + Intronic
938833661 2:135077744-135077766 TCATTCTAATGAGTATGAAGTGG + Intronic
938836504 2:135108375-135108397 TCACCCTAGTAGGTATGTAGTGG + Intronic
939018670 2:136932683-136932705 TCAGCCTACTTAACATGAAGAGG - Intronic
939534316 2:143407302-143407324 TCATCTTAAAAAATATGAATGGG - Intronic
940228463 2:151425092-151425114 CCATCCTAGTGAATGTGAAGTGG + Intronic
940863534 2:158794182-158794204 CCATCCTAATACATATGTAGTGG + Intergenic
941088711 2:161148215-161148237 CCATCCTAGTGAATGTGAAGTGG + Intronic
941357038 2:164506395-164506417 TCATTCTAGTGGATGTGAAGTGG - Intronic
941435607 2:165467541-165467563 CCGTCCTAATAAATATGAGGTGG + Intergenic
941879914 2:170470762-170470784 TCATTCTAGTTGATGTGAAGTGG + Intronic
941904692 2:170709410-170709432 TCATCCTAGTAGGTGTGAAGGGG + Intergenic
942035137 2:172003387-172003409 AGATCCCAGTGAATATGAAGAGG + Intronic
942255731 2:174096023-174096045 TCATCCTAGTAGATGTGAAGTGG - Intronic
942412936 2:175730411-175730433 CCCTGCTAGTTAATATGAAGTGG + Intergenic
942550432 2:177110403-177110425 CCATTCTAGTAGATGTGAAGTGG - Intergenic
942650834 2:178165590-178165612 TCATCCTTCTAAATATAAACTGG + Intergenic
942676607 2:178433539-178433561 CCATCCTAGTGGATTTGAAGTGG + Intronic
942999788 2:182311965-182311987 TCATCCTAATAGATGTGTAGTGG + Intronic
943687426 2:190833316-190833338 TCATTCTAGTGAGTATGAAATGG + Intergenic
944041502 2:195360553-195360575 TCATCTTAGTAAAAATGAAATGG + Intergenic
945237886 2:207649364-207649386 CCATCCTAGCAGGTATGAAGTGG - Intergenic
945420049 2:209624207-209624229 TCTTCCTAGAAGATATGACGGGG + Intronic
946659000 2:221979295-221979317 TAATCCTAGGAAACATGGAGAGG - Intergenic
946739348 2:222786620-222786642 CCATCCTAGTGGATGTGAAGTGG - Intergenic
947130004 2:226912157-226912179 ACATCCTAGGGCATATGAAGTGG - Intronic
947305065 2:228736587-228736609 TAATCATAGTAAATAAGAACTGG - Intergenic
947469856 2:230391407-230391429 TCATCCTAGTGAGTGTGATGTGG + Intronic
948362320 2:237431570-237431592 TCATCCTAGTGAATTGGAAGTGG - Intergenic
948553788 2:238793654-238793676 TCATCCTGATGAATGTGAAGTGG + Intergenic
948751433 2:240135742-240135764 TCATTCTAGTTAAGATTAAGAGG + Intronic
1168770548 20:412169-412191 CCATCCTAGTAAGTTTGAAGAGG + Intronic
1169238684 20:3955047-3955069 GCATCCTAGTAGGTGTGAAGTGG + Intronic
1169646379 20:7814437-7814459 CCATTCTAGTGAGTATGAAGTGG - Intergenic
1169829223 20:9805176-9805198 CCATCCTAGTGAGTGTGAAGTGG - Intronic
1169932255 20:10846859-10846881 CCATCCCAGTAGATGTGAAGTGG - Intergenic
1170080961 20:12475012-12475034 CCATCCTAGTAAGTTTGAAGTGG + Intergenic
1170119803 20:12899705-12899727 TCATCCTAACAGGTATGAAGTGG + Intergenic
1170798144 20:19568088-19568110 TCATCCTAATAGGTGTGAAGTGG - Intronic
1170940206 20:20842455-20842477 TCCTCCCAGTAAATAAAAAGTGG + Intergenic
1170959633 20:21013782-21013804 TCCTCCTATAAAATATGAACTGG + Intergenic
1172019484 20:31903185-31903207 CCATCCTAGTGGGTATGAAGTGG + Intronic
1172454852 20:35062104-35062126 CCATCGTAGTAGGTATGAAGAGG - Intronic
1172638396 20:36425382-36425404 TCATCCTAGTAGGTGTGAACTGG - Intronic
1173964801 20:47104125-47104147 TAGTCCTAGTAAGTATGAAGTGG + Intronic
1174333201 20:49837410-49837432 CCATCCTAGTAGGTATGGAGTGG + Intronic
1175221424 20:57419108-57419130 CCATCCTAGTGAATGCGAAGTGG - Intergenic
1175614567 20:60384812-60384834 TCATCTTAGTGGATGTGAAGTGG - Intergenic
1178869975 21:36365307-36365329 TCATTCTATTAAATTGGAAGAGG - Intronic
1180128851 21:45812078-45812100 TCCTCATAGTAAATGTGAAAAGG - Intronic
1180919225 22:19511187-19511209 TCATCCTAGTGAGTATGAAGTGG + Intronic
1181146162 22:20849148-20849170 CCATCCTAGTGGATGTGAAGTGG - Intronic
1181158705 22:20943068-20943090 CCATCCTAGTAGGTGTGAAGTGG + Intronic
1181739486 22:24909316-24909338 CCATCCCAGTGTATATGAAGTGG - Intronic
1182537561 22:31016477-31016499 TTATTCTAGTAAGTATGAAGTGG + Intergenic
1182643474 22:31788237-31788259 TCATCCTAGTGGGTGTGAAGTGG - Intronic
1184983316 22:48111652-48111674 CCAACCTAGTAGGTATGAAGTGG - Intergenic
1185412290 22:50689538-50689560 CCATCCTAGTAAGTGTGAAATGG + Intergenic
950084083 3:10244660-10244682 CTATCCTAGTGAATGTGAAGTGG - Intergenic
950226463 3:11239200-11239222 TCATCCTAGTCCATGTGAAGTGG + Intronic
950241612 3:11375457-11375479 CCATCCTAGTGAGTATGAAATGG - Intronic
950734844 3:14998454-14998476 CCATCCTAGTGGATATGAAGTGG + Intronic
951022500 3:17796405-17796427 CCATCCTAATAAGTGTGAAGTGG + Intronic
951053035 3:18116051-18116073 CCATTCTAATAAATATGCAGTGG + Intronic
951112043 3:18815180-18815202 TCATTCTAGTGGATGTGAAGTGG + Intergenic
951487075 3:23224983-23225005 CTATCCTAGTAGATATGAAGTGG + Intronic
951521429 3:23614460-23614482 CCATCCTAGTGAGTGTGAAGTGG + Intergenic
951523890 3:23634885-23634907 TCATCCTAGTGGGTATAAAGTGG + Intergenic
952731492 3:36641445-36641467 TCATACTAGTGTGTATGAAGTGG + Intergenic
952909369 3:38169126-38169148 CCATCCTAGTGACTATGAAGTGG + Intronic
953085412 3:39661159-39661181 TCATTCTAATAAATATGCACTGG - Intergenic
953467518 3:43136291-43136313 TCATCCAAGTAGGTATGAATTGG + Intergenic
953803111 3:46043948-46043970 CCATCCTAGTGGGTATGAAGTGG + Intergenic
953833114 3:46319268-46319290 TCATCCTAGTGGGTATGAAGTGG + Intergenic
953862291 3:46554930-46554952 CCATCCTAGTAGGTGTGAAGAGG + Intronic
954095461 3:48323103-48323125 CCATCCTAGTAGGTGTGAAGTGG + Intronic
954740935 3:52749900-52749922 TCATCCTAGTAGGTATGAAGTGG - Intronic
954842045 3:53520329-53520351 CCATCATAGTGCATATGAAGTGG + Intronic
956593179 3:70937917-70937939 TCATCTTAATAGATATGTAGTGG + Intergenic
956640256 3:71408793-71408815 TCATCCTAGTAATTAGAAACCGG - Intronic
956733633 3:72218849-72218871 TCATCATAGAATATATCAAGTGG - Intergenic
956919947 3:73917392-73917414 GCATCCTAGTAGATGTGAAGTGG - Intergenic
958253519 3:91297693-91297715 TCATCCTAGTGGATGTGAAGTGG - Intergenic
958903295 3:99913384-99913406 TTATCGTAGTGGATATGAAGTGG + Intronic
958947137 3:100376079-100376101 CCATCCTAGTAGGTGTGAAGTGG + Intronic
959044242 3:101453969-101453991 CCATCCTAGTGAGTGTGAAGTGG - Intronic
959272572 3:104232048-104232070 TCTTGCTAGTAAATTTGAACTGG + Intergenic
959760036 3:109950943-109950965 CCATCCTAGTACATGTGATGTGG - Intergenic
960146293 3:114207435-114207457 TCATCCTAGTAGTTATGAAGTGG + Intergenic
960499940 3:118425262-118425284 GCATCCTAGTAGATATAAAGTGG - Intergenic
960590182 3:119358305-119358327 TCATCCTAGTAGTTGTGAAGTGG - Intronic
960635053 3:119776758-119776780 CCATCCTAGTAGGTGTGAAGTGG - Intergenic
960981783 3:123235483-123235505 CCATCCTAATACATATGAAGTGG - Intronic
961258300 3:125577459-125577481 TTATCTTAGTGGATATGAAGTGG - Intronic
961624345 3:128249938-128249960 ACATCCTAGGAGGTATGAAGTGG + Intronic
963019384 3:140857829-140857851 TTATCCTAGTGGATGTGAAGTGG - Intergenic
963047459 3:141113095-141113117 CCATCCTAGTGGGTATGAAGTGG - Intronic
963659337 3:148104265-148104287 TCAAACAAATAAATATGAAGGGG + Intergenic
963862951 3:150329592-150329614 CCATCCTAGTAAGTGTGAGGTGG - Intergenic
963967061 3:151383967-151383989 GCATCCAAGTAAATAAGATGTGG - Intronic
964016604 3:151955120-151955142 TCTTCCTCCTAAACATGAAGAGG + Intergenic
964145117 3:153451070-153451092 TCATCTTAGTAAGTGTGAATGGG + Intergenic
964363074 3:155918477-155918499 TCATCCTAGTGTATATGAAGTGG + Intronic
964643309 3:158932490-158932512 TCATCCTATCACATGTGAAGTGG - Intergenic
964788149 3:160422385-160422407 TCATCTTAGTGAATATGAAGTGG + Intronic
964789831 3:160443258-160443280 TCATCCTAGAAAATATACATAGG - Intronic
964995494 3:162873859-162873881 TCATCCATGTAAACATGAATAGG - Intergenic
965637516 3:170798852-170798874 CCATCCTAGTGGATGTGAAGTGG - Intronic
965703575 3:171483109-171483131 CCATTCGAGTGAATATGAAGTGG + Intergenic
965844290 3:172944313-172944335 GCATCCTAACAGATATGAAGTGG - Intronic
966370938 3:179250129-179250151 TCAGCCTACTCAACATGAAGAGG - Intronic
966722386 3:183077425-183077447 GCATCCTAGTGAGTATGAAGTGG + Intronic
967566942 3:190984372-190984394 CTAACCTGGTAAATATGAAGTGG - Intergenic
967579082 3:191130841-191130863 CCATTCTAGTGAATATGAAGTGG - Intergenic
967607246 3:191461679-191461701 CCAGCCTAGTGGATATGAAGTGG - Intergenic
968020275 3:195379937-195379959 CCATCCTAGTAGGTGTGAAGTGG - Intronic
968889022 4:3357070-3357092 TCATCCTAGTGAGTGTGAAGTGG + Intronic
969644423 4:8418964-8418986 CCATCCTAGTGGATGTGAAGTGG - Intronic
969942220 4:10745018-10745040 CCATCCTAATAAGTGTGAAGTGG - Intergenic
970058931 4:12007525-12007547 CCATCCTAGTGAGTATGAAGTGG + Intergenic
971288845 4:25316506-25316528 CCATCCTAGTAATTGTGAAGTGG + Intronic
972493219 4:39607979-39608001 CCATACTAGTAGGTATGAAGTGG - Intronic
972702985 4:41512206-41512228 CCATCCTAGTAGGTGTGAAGTGG - Intronic
972849441 4:43030880-43030902 TCATCCTAGTCAATAGGGTGAGG - Intergenic
973269475 4:48247190-48247212 TCCTCCTAGTGTGTATGAAGTGG - Intronic
973530112 4:51828813-51828835 CCATCCTAGTAAGTATGAAAGGG + Intergenic
973594761 4:52476331-52476353 CCATCCTAGTGCACATGAAGTGG - Intergenic
973611769 4:52642569-52642591 TCATTCTAGAAAATTTCAAGGGG - Intronic
973964551 4:56148229-56148251 CTATCCTAGTGGATATGAAGTGG + Intergenic
974245181 4:59305311-59305333 TCATCCTAGTGGATATGAGGTGG - Intergenic
974379952 4:61126551-61126573 TCATCTTACTAGATGTGAAGTGG + Intergenic
975123176 4:70751578-70751600 TAATCCTAGTAAAAAAGAATGGG - Intronic
975223993 4:71848157-71848179 ATATCCTTGTAAATATGATGTGG + Intergenic
975461198 4:74655357-74655379 TCATCTTTGTTAATATGAAGTGG - Intergenic
975530936 4:75398709-75398731 TCATCCTAGTGGGTATGAAGTGG - Intergenic
975767574 4:77684974-77684996 CCATCCTAGTGGATATAAAGTGG - Intergenic
976409742 4:84699745-84699767 TCATCCTAGTAAATATGAAGTGG + Intronic
976437948 4:85040837-85040859 TCATCTTAGTGAGTGTGAAGTGG + Intergenic
976515510 4:85959843-85959865 CCATTCTAGTGAATATGAAATGG + Intronic
977282929 4:95064829-95064851 CCATCCTAGTACATGTGAAGTGG - Intronic
977333964 4:95672660-95672682 ACATCCTAGTAATTAGAAAGAGG - Intergenic
977401238 4:96535008-96535030 TCACCCAAGTAAAAATGCAGTGG - Intergenic
978263890 4:106798719-106798741 TCATCTTGGGAAATGTGAAGTGG + Intergenic
978713918 4:111818997-111819019 CCATCCTAATGAATGTGAAGTGG - Intergenic
978750734 4:112243843-112243865 TTTTTCTAGTAAATTTGAAGAGG - Intronic
978757259 4:112315916-112315938 TCATTGTAGAAAATAGGAAGAGG + Intronic
979143363 4:117206893-117206915 TTATCCTAGTAAGTGTGAAATGG - Intergenic
979270654 4:118756709-118756731 TCATGCGAGGAAATATGAACAGG - Intronic
979319718 4:119309126-119309148 CCATCCTAGTAGATGTGAAATGG - Intergenic
979615556 4:122738802-122738824 ATATCCTAGTGAATGTGAAGTGG - Intronic
979744497 4:124194585-124194607 TCATCTTAGTGAGTGTGAAGTGG + Intergenic
980030407 4:127822674-127822696 TCATCCTAGTGAGTGTGAAGTGG + Intronic
980106708 4:128595066-128595088 TCATCCTTGTTACAATGAAGTGG + Intergenic
980218835 4:129887696-129887718 TCATCATAGTAAAAATGAAATGG - Intergenic
981476666 4:145193931-145193953 CCATCCTAGTATGTGTGAAGTGG - Intergenic
981730409 4:147890930-147890952 CCATCCTAGTAGATATAAAGTGG - Intronic
981868213 4:149453669-149453691 TCATTCTAGTAGATGTGAAGTGG - Intergenic
981997575 4:150991159-150991181 TCATTCTAGTAAGTTTGTAGTGG - Intronic
982415378 4:155125223-155125245 TCATCCTAATGAATGTGAGGTGG - Intergenic
982811355 4:159829984-159830006 TTATCCTAGGTAAGATGAAGTGG + Intergenic
982986132 4:162209174-162209196 TCATCCTAGTGTGTGTGAAGTGG - Intergenic
983763748 4:171450150-171450172 AAGTCTTAGTAAATATGAAGTGG - Intergenic
986109515 5:4698400-4698422 TCATCCTAGCAGGTATGCAGTGG - Intergenic
986565805 5:9112756-9112778 TCCTCCTATTGAATATGAATGGG + Intronic
986565891 5:9113753-9113775 CCATCCTAGTAGGTATGAACTGG - Intronic
987587215 5:19871571-19871593 TCATATTAGGAAATATTAAGAGG - Intronic
987676537 5:21081251-21081273 TCATCCTCATAAATAGGAAGAGG + Intergenic
988071407 5:26293259-26293281 TCATCCTAAGGAAAATGAAGTGG - Intergenic
988320802 5:29693779-29693801 TCATCCTAATGAATGTGAAGTGG + Intergenic
988850750 5:35178004-35178026 CCATCCTAGTGACTGTGAAGAGG + Intronic
988877563 5:35464290-35464312 CCATCCTAGTAGGTATGAGGTGG - Intergenic
988892366 5:35631417-35631439 CCATCCTAGTGGGTATGAAGTGG - Intronic
989478281 5:41899432-41899454 CCATCCTAGTGGATATGAAGTGG + Intergenic
989755825 5:44952548-44952570 GCATCCTAGTGGATGTGAAGTGG + Intergenic
990131622 5:52593455-52593477 CTATCCTAGTGGATATGAAGAGG - Intergenic
990221244 5:53591483-53591505 CTATCGTAATAAATATGAAGTGG + Intronic
990392993 5:55346524-55346546 TCATCCTATTGAATGTGAAGTGG + Intronic
991060743 5:62372769-62372791 TCATCCTTAAAAATATGAGGGGG - Intronic
991268085 5:64746637-64746659 TCATCCTCATAGGTATGAAGTGG - Intronic
991298991 5:65109510-65109532 CCATCTTAGTAAGTGTGAAGTGG + Intergenic
991621858 5:68552881-68552903 TCAGCCTATTCAATGTGAAGAGG - Intergenic
991711194 5:69410341-69410363 TCATCCTAATAGATGTGAATTGG + Intronic
991715904 5:69450805-69450827 CCATCCTAATAGATGTGAAGTGG + Intergenic
992240270 5:74761969-74761991 TTATCCTAGTCATTATGCAGTGG - Intronic
992285548 5:75231706-75231728 CCATCCTAATGAGTATGAAGTGG - Intronic
992547524 5:77828627-77828649 CCATCCTAGTGGGTATGAAGTGG - Intronic
992662899 5:78979286-78979308 TCATCCTAGTGAGTAGGAAGTGG - Intronic
992757305 5:79920004-79920026 CCATCCTAGTAGATGAGAAGTGG - Intergenic
992813966 5:80417977-80417999 ACATTCTAGTAGATGTGAAGTGG + Intronic
992845388 5:80741833-80741855 TCATCACTGAAAATATGAAGCGG + Intronic
993049064 5:82904384-82904406 ACATTCTAGTAGATATGTAGTGG + Intergenic
994196374 5:96927342-96927364 CTATCCTAGTAGATGTGAAGTGG + Intronic
994787557 5:104183542-104183564 TCATCCTAATGGCTATGAAGTGG + Intergenic
994838169 5:104884312-104884334 CCATCCTAGTGGGTATGAAGTGG - Intergenic
995120130 5:108527310-108527332 CCATCCTAGTGAGTATAAAGTGG + Intergenic
995478782 5:112574465-112574487 TCATGCTAATAAATATGAACAGG + Intergenic
995577327 5:113552849-113552871 TCATCCTAGTTGGTGTGAAGTGG + Intronic
996217035 5:120881431-120881453 TAATCCTTGGAAAGATGAAGAGG - Intergenic
996915679 5:128709456-128709478 TCATGCTAGAAAATAAAAAGAGG - Intronic
997620780 5:135291835-135291857 CCATCCTAATGGATATGAAGTGG + Intronic
998437604 5:142125798-142125820 CCATCCTAGTAAGCATGAAGTGG + Intronic
999000463 5:147916138-147916160 TCATCATAGTAGGTATGGAGTGG + Intergenic
999017644 5:148125705-148125727 TCATCCTAGAAAATGAGAAAGGG - Exonic
999118715 5:149189658-149189680 CCATTCTAGTAGATGTGAAGTGG - Intronic
999235631 5:150091090-150091112 TGATCCTAGTAGATATGAAGTGG - Intronic
999313407 5:150568545-150568567 CCATCCTAATGGATATGAAGTGG + Intergenic
999749041 5:154612891-154612913 TCATTCTAGTAAATGTGTAGTGG - Intergenic
1000365025 5:160482546-160482568 TTATCCTAGTAGGTGTGAAGTGG - Intergenic
1001297119 5:170505851-170505873 ACATCCTAGAACATAGGAAGAGG + Intronic
1001347574 5:170920353-170920375 TCATTCTAATAACTATGTAGTGG + Intronic
1001351977 5:170977297-170977319 TCATCCTAGTGAGTGTAAAGTGG - Intronic
1003371774 6:5535054-5535076 CCACCCTAGTAGATGTGAAGTGG + Intronic
1004024947 6:11809161-11809183 CCATCCTAGTGAGTATGAAGTGG - Intergenic
1004101342 6:12615273-12615295 TTATTCTGGTTAATATGAAGTGG - Intergenic
1004579576 6:16936624-16936646 TCATCCTAGTGGATATGAAGTGG - Intergenic
1004597361 6:17112959-17112981 TTATCCTAGGGTATATGAAGTGG + Intronic
1004762581 6:18685551-18685573 CCATCCTAGTGGATATGTAGTGG + Intergenic
1005573470 6:27169964-27169986 TCATCCAAGTAGGTATGGAGTGG + Intergenic
1007862431 6:44926112-44926134 TAATCCTAATAAATAGGAACTGG + Intronic
1008072128 6:47108276-47108298 TCATCTTAGTATTTATGTAGAGG - Intergenic
1008101989 6:47401609-47401631 ACATTCCAGTAAATATGAACAGG - Intergenic
1008967584 6:57328848-57328870 CCATCATAGTGAGTATGAAGTGG + Intronic
1009190950 6:60629341-60629363 TCATCCTAGTGGATGTGAAGTGG + Intergenic
1009326754 6:62360054-62360076 TCATCCTAATGGGTATGAAGTGG - Intergenic
1009555933 6:65166996-65167018 TCATCCTAGTGGGTGTGAAGGGG - Intronic
1009790637 6:68397490-68397512 CCATCCTAGTGGGTATGAAGTGG - Intergenic
1009974267 6:70656221-70656243 TCATTCTAGTAGGTATAAAGTGG + Intergenic
1010037837 6:71346454-71346476 TAATCATAGAAACTATGAAGTGG - Intergenic
1010794368 6:80102380-80102402 TCATCCTAGTGGATATGAAGTGG + Intergenic
1010923122 6:81709018-81709040 TCATTCTAGTAGATGTGTAGTGG + Intronic
1011574012 6:88774269-88774291 TCACCCTAGTTAGTATGAAGTGG - Intronic
1011637786 6:89390465-89390487 CCATCCTAGTAGGTGTGAAGTGG - Intronic
1011784048 6:90824584-90824606 CCATTCTAGTAGGTATGAAGTGG + Intergenic
1012554633 6:100496577-100496599 CCATCCTAGTGAGTGTGAAGTGG + Intergenic
1013736685 6:113235391-113235413 TCATTCCAGTCAATAAGAAGAGG + Intergenic
1013742403 6:113302701-113302723 CCATTCTACTAAATATGTAGTGG - Intergenic
1013894698 6:115072233-115072255 CCATCCTAGTAGGTATAAAGTGG - Intergenic
1013897572 6:115108644-115108666 CCATCCTAATGAGTATGAAGTGG - Intergenic
1014411224 6:121124096-121124118 TCTTCTTAGTAAAGATTAAGTGG + Intronic
1015770994 6:136768497-136768519 CCATCCTAGTGGATGTGAAGTGG - Intronic
1016456794 6:144239310-144239332 TCATCCTAGGCAACATGGAGAGG - Intergenic
1016726865 6:147381335-147381357 CCATCCTAGTAAGTTTGAAGTGG - Intronic
1016972879 6:149781040-149781062 CCATCCTAGTGACTATGAAGTGG + Intronic
1017149988 6:151270714-151270736 ACATCCTAGTGAGTGTGAAGTGG + Intronic
1017532178 6:155306152-155306174 CCATCCTAGTGAATATGTAATGG - Intronic
1018059624 6:160080157-160080179 TCTTCCCATTGAATATGAAGGGG - Exonic
1018241855 6:161784579-161784601 TCATCCTAGTAAGTGTGAAGTGG - Intronic
1018842819 6:167530811-167530833 TCATCCTAGAAAATAAGATTGGG - Intergenic
1019831102 7:3331336-3331358 TGATCCTAATAAGTGTGAAGTGG + Intronic
1020146077 7:5644368-5644390 TCATCCTAATAGGTGTGAAGCGG + Intronic
1020247956 7:6444948-6444970 CCATCCTAGTGAATGTGAAGTGG - Intronic
1020555905 7:9670133-9670155 TCAGCCTACTTAATGTGAAGAGG - Intergenic
1020738638 7:11985117-11985139 CCACCCTAGTGAATATGAAGTGG - Intergenic
1021472257 7:21017590-21017612 CCATTCTAGTAAACATGTAGAGG + Intergenic
1021544880 7:21802288-21802310 TCATCCTGGTGGTTATGAAGTGG - Intronic
1021825037 7:24541710-24541732 TCATCCTAGACAATGTGAAGTGG + Intergenic
1022063844 7:26829710-26829732 CCATCCTAGTGAATGTGAAGTGG - Intronic
1022408831 7:30120117-30120139 CCATCCTACTGAGTATGAAGAGG - Intronic
1022602019 7:31770098-31770120 GCATCCTAGTGCATGTGAAGTGG + Intronic
1022836025 7:34115997-34116019 CCATCCTAGTGGGTATGAAGTGG + Intronic
1023104358 7:36748876-36748898 CCATCCTAGTAAGTATGAAGTGG - Intergenic
1023215040 7:37853014-37853036 TCATCCTAATAAGTGTGTAGTGG + Intronic
1023247459 7:38220429-38220451 TCATCCTAATCGGTATGAAGCGG - Intronic
1023375482 7:39551220-39551242 TCAGCCTACTCAATGTGAAGGGG + Intergenic
1024362536 7:48483386-48483408 TTCACCTAGTAAATATAAAGTGG + Intronic
1024869355 7:53943869-53943891 TCATTCTAATAGGTATGAAGTGG + Intergenic
1026028161 7:66764160-66764182 TCATCCTACTGGATGTGAAGTGG + Intronic
1026459510 7:70601208-70601230 CCATTCTAGTGAATGTGAAGTGG + Intronic
1026961111 7:74408125-74408147 GCATCCTAGTGGGTATGAAGTGG - Intergenic
1027210120 7:76140100-76140122 TCATCCTACTGGATGTGAAGTGG - Intergenic
1027592774 7:80135601-80135623 TCAGCCTTGTAAAGATGAAGGGG + Intronic
1028458454 7:91063956-91063978 CATTCCTAGTAACTATGAAGTGG + Intronic
1028770210 7:94610951-94610973 CCATCCTAGTGAAAGTGAAGTGG - Intronic
1029250022 7:99229517-99229539 TCATACTAGTGGATGTGAAGTGG - Intergenic
1029430751 7:100528159-100528181 CCATCCTAGTGGATGTGAAGTGG + Intergenic
1029933000 7:104393118-104393140 CCATCCTAGTGGGTATGAAGTGG - Intronic
1029963866 7:104717608-104717630 TCATCCTAATGAGTATGAGGTGG - Intronic
1030015433 7:105215300-105215322 CCATCCTAGTAGGTGTGAAGTGG - Intronic
1030730157 7:112978292-112978314 TTTTCCTAGTAAATAAAAAGTGG + Intergenic
1030772808 7:113495837-113495859 TTTTCCTAGTAAATAAAAAGTGG + Intergenic
1031805443 7:126301703-126301725 TCATCCTGGCAATTATGAAGGGG + Intergenic
1032124381 7:129181986-129182008 TCATCCTAATAAATGTGAAGTGG + Intergenic
1032275439 7:130450955-130450977 CCATCCTACTGGATATGAAGTGG - Intergenic
1032598971 7:133272663-133272685 TCATCCTAGTTTACATCAAGAGG + Intronic
1032980069 7:137271389-137271411 TCATCCTTGTAAAGATTAATAGG - Intronic
1033838553 7:145345846-145345868 CCATCCTACTAAATGTGAAATGG - Intergenic
1034399236 7:150850766-150850788 CCATCCTAGTGGATATAAAGTGG + Intronic
1034576113 7:151999542-151999564 TCATCCTAGTGGAAGTGAAGTGG + Intronic
1034846299 7:154449377-154449399 TCATCCTAGTGGATGTGAAGTGG - Intronic
1036603283 8:10283324-10283346 TACTCCTAATAAATATGAAGAGG - Intronic
1037357887 8:18042038-18042060 ACATTCTAGTACATATGTAGTGG + Intergenic
1038137977 8:24811016-24811038 CCATCCTAATAGGTATGAAGTGG - Intergenic
1038223683 8:25634826-25634848 TGATCCTTGTAGATGTGAAGTGG + Intergenic
1038388996 8:27177332-27177354 CCATCCTAGTGGATATAAAGTGG - Intergenic
1038582444 8:28760705-28760727 CCATCCTAGTAGGTGTGAAGTGG + Intergenic
1038871233 8:31496009-31496031 CCATCCTAGTAGATGTGAAGTGG + Intergenic
1039273452 8:35908264-35908286 TCATCTTAGTAGGTGTGAAGTGG + Intergenic
1039581863 8:38673448-38673470 TCATTCTAATGGATATGAAGTGG + Intergenic
1040461808 8:47656459-47656481 CCATCCTAGTGACTGTGAAGTGG - Intronic
1040646800 8:49407106-49407128 TCATGCTAGTGGGTATGAAGTGG + Intergenic
1041799243 8:61780765-61780787 CCATCCTAGTAGATGTGAAGTGG + Intergenic
1041930169 8:63277733-63277755 CCATACTAGGAGATATGAAGGGG - Intergenic
1042162205 8:65908357-65908379 CCATCCTAGTAGGTATAAAGTGG - Intergenic
1042163811 8:65925290-65925312 CCATCCTAGTGAGTATGAAATGG + Intergenic
1042689119 8:71477517-71477539 TCATCCTAGTACATAGGGAGTGG - Intronic
1042814195 8:72860366-72860388 TCATCCTAGTAGATGTGAAATGG + Intronic
1043008145 8:74846339-74846361 CCATTCTAATAATTATGAAGAGG - Intronic
1043029428 8:75114282-75114304 CCATGCTAGTGGATATGAAGTGG + Intergenic
1043365534 8:79528758-79528780 CCATCCTAGTAGATGTGCAGTGG + Intergenic
1043681543 8:83032972-83032994 TCATCCTAATAAGTATGTAGTGG + Intergenic
1043949627 8:86293182-86293204 TCAGCCTACTCAATGTGAAGAGG - Intronic
1043985226 8:86687084-86687106 CCATCCTAGTGAGTGTGAAGTGG - Intronic
1044002112 8:86895637-86895659 GCATTCTAGTAAATGTGTAGTGG + Intronic
1044657868 8:94567018-94567040 CCATCCTAATGGATATGAAGTGG - Intergenic
1045070342 8:98497747-98497769 TCATCCTAGTGAGTATGAAGTGG - Intronic
1045246586 8:100446836-100446858 CCATCCTTGTAGATATGAAGTGG + Intergenic
1045578617 8:103453508-103453530 TCAACCTAGGAAGTATGTAGTGG - Intergenic
1045665470 8:104479737-104479759 CCATCCCAGTAATTGTGAAGTGG + Intergenic
1046498010 8:115039287-115039309 TCACCCTAGTACATGTGAAGTGG + Intergenic
1047260002 8:123247504-123247526 CCATCCTAGTAAGTATGAAGTGG - Intronic
1047534105 8:125703627-125703649 CCATACTAGCAAAAATGAAGAGG - Intergenic
1047755388 8:127914208-127914230 CCATCCTAGTAGGTATGAAGGGG - Intergenic
1048096096 8:131296521-131296543 TCATGCTAGTGAGTGTGAAGTGG + Intergenic
1049048132 8:140169240-140169262 CCATCCTAGTGGATGTGAAGTGG - Intronic
1049072462 8:140367213-140367235 TCATTTGAGTAAATATCAAGGGG - Intronic
1050133134 9:2433515-2433537 CCATCCTAGTGGGTATGAAGTGG + Intergenic
1050228702 9:3492957-3492979 CCATCCTTGTAAATAGGATGTGG - Intronic
1050511227 9:6397811-6397833 TCATCCTAGTCATTATGGACTGG + Intergenic
1050898750 9:10917280-10917302 TCCTCCTACTAAATAAGAATTGG + Intergenic
1051198834 9:14594979-14595001 CCATCCAAGTTAATATGTAGTGG - Intergenic
1051789632 9:20785943-20785965 ACATCCTAGTAGGTGTGAAGTGG + Intronic
1052523421 9:29580973-29580995 CCATCCTAGTGGATATGAAGTGG - Intergenic
1053033641 9:34805394-34805416 CCATCCCAGTGAGTATGAAGTGG + Intergenic
1053099337 9:35357265-35357287 CCATCCTAGTGGATATGAAGTGG + Intronic
1055005568 9:71501988-71502010 TCTTTCTAGTAAGTATGTAGTGG - Intergenic
1055134182 9:72808039-72808061 TCATCCTGGAAAATATGACCTGG + Intronic
1055180211 9:73378188-73378210 CCATCCTAGTGGATATAAAGTGG + Intergenic
1055361468 9:75495614-75495636 TCATTCTAGCAAAAATGATGAGG - Intergenic
1055980895 9:81999363-81999385 CCATCCTAGTAGGTGTGAAGTGG - Intergenic
1056123246 9:83510325-83510347 TCATCCTAGTGGATTTGAAGTGG - Intronic
1056251040 9:84748400-84748422 TCAACCTAGAAAATGGGAAGTGG - Intronic
1056651682 9:88470498-88470520 CCATCCTAGTGGATGTGAAGTGG + Intronic
1056903102 9:90619478-90619500 CCATCCAAGTGAGTATGAAGCGG - Intronic
1057295385 9:93832214-93832236 CCATCCTAGTAAGTGTAAAGTGG + Intergenic
1057425280 9:94944063-94944085 CCATCCTAGTAGGTATGAAGTGG - Intronic
1057760036 9:97864603-97864625 TCATCCTGGTAAGTGTGCAGAGG + Intergenic
1057984646 9:99699986-99700008 TAATCCTAGTAAATGTGATATGG - Intergenic
1058024276 9:100123794-100123816 CCATCCTAGTGTATGTGAAGTGG + Intronic
1058079121 9:100683353-100683375 CCATTTTAGTAAATTTGAAGTGG - Intergenic
1058304169 9:103416168-103416190 TCATCCTAATTAGTATGAGGTGG + Intergenic
1058887565 9:109333049-109333071 TTATCCTAATAGATGTGAAGTGG - Intergenic
1059252692 9:112900961-112900983 CCATCCTAGTGGATGTGAAGTGG - Intergenic
1059474590 9:114534647-114534669 CCATCCTAGTGGGTATGAAGTGG - Intergenic
1059997261 9:119923943-119923965 TCATCTTAGTAGGTGTGAAGTGG - Intergenic
1060077927 9:120611044-120611066 CCATCCTAGTAGATATGAAGTGG - Intronic
1060426678 9:123512236-123512258 TCATAATAGGAGATATGAAGAGG + Intronic
1060710693 9:125860961-125860983 TCATCCTAGTAAGTGTAAAGTGG - Intronic
1061142677 9:128777925-128777947 TCATCCTAGTAGGTGAGAAGTGG - Intergenic
1061143853 9:128785582-128785604 ACATTCTAGTAGATGTGAAGTGG - Intergenic
1062335796 9:136066455-136066477 CCATCCTAGTGGGTATGAAGTGG - Intronic
1186045451 X:5532110-5532132 TCATTGGAGTAGATATGAAGAGG + Intergenic
1186519861 X:10196161-10196183 CCATCCTAGTGGTTATGAAGTGG + Intronic
1187149040 X:16665092-16665114 CCATCCTAGTGGATGTGAAGTGG - Intronic
1187324709 X:18275877-18275899 CCATCCTAGTGAGTATGAAGTGG - Intronic
1187371379 X:18710043-18710065 TCATCCTAGTGGGTATGAAGTGG + Intronic
1187516169 X:19973159-19973181 CCATCCTAGTGGGTATGAAGTGG + Intergenic
1187855236 X:23630432-23630454 CCATTCTAGTAGATGTGAAGTGG - Intergenic
1187910494 X:24106735-24106757 CCATCCTAGTGGATGTGAAGTGG + Intergenic
1188298590 X:28480866-28480888 CCATCCTAGTGTGTATGAAGTGG + Intergenic
1188376447 X:29435517-29435539 CCATCCTAGTGAATGCGAAGTGG + Intronic
1189405496 X:40719109-40719131 CCATCCTAGTAGGTATGAAGTGG - Intronic
1189532920 X:41905419-41905441 CCATCCTAGTGCACATGAAGTGG + Intronic
1189645653 X:43127344-43127366 TCATATTAATAAATATGAAAAGG + Intergenic
1190478982 X:50856183-50856205 TCATCCTAGTAGGTATAAAGAGG + Intergenic
1190559776 X:51675600-51675622 TCATCCTACTGAGTGTGAAGTGG + Intergenic
1190564515 X:51717721-51717743 TCATCCTACTGAGTGTGAAGTGG - Intergenic
1190851188 X:54243612-54243634 CCATCCTGGTAAGTATAAAGTGG - Intronic
1191129919 X:56996509-56996531 CCATCCTAGTGGGTATGAAGTGG + Intergenic
1192022265 X:67406548-67406570 TCATTCTAGTGAATGTGAAGTGG - Intergenic
1192405129 X:70877330-70877352 TCATCCTAGTGACTGTGAGGTGG - Intronic
1192604768 X:72504896-72504918 CCATCCTAGTATGTGTGAAGTGG + Intronic
1193133714 X:77946699-77946721 CCATCCTAGTGGATGTGAAGTGG - Intronic
1193178085 X:78419163-78419185 CCATCCTAATAAGTGTGAAGTGG - Intergenic
1194211495 X:91075163-91075185 TCATTCTAGTAGCTGTGAAGAGG - Intergenic
1194418462 X:93642545-93642567 TCATCCTAGTGAATGTAAAGTGG - Intergenic
1194535291 X:95098870-95098892 TCACCCTAGTGGGTATGAAGTGG - Intergenic
1194670387 X:96724647-96724669 TAAACCCATTAAATATGAAGTGG - Intronic
1194750206 X:97675755-97675777 ACATCCTAGTGAGTATGATGTGG + Intergenic
1194988284 X:100515555-100515577 CCATTCTAGTATGTATGAAGTGG + Intergenic
1195274814 X:103271534-103271556 CCATCTTAGTGGATATGAAGTGG - Intergenic
1195304643 X:103568810-103568832 CCATCCTAATGAATGTGAAGTGG - Intergenic
1195379746 X:104259383-104259405 CCATCCTAGTAGGTACGAAGTGG + Intergenic
1195511305 X:105718580-105718602 GCATCCTAGTGAGTATAAAGTGG - Intronic
1195956868 X:110340556-110340578 TCACACTAGTAACTATTAAGTGG - Intronic
1196182496 X:112707536-112707558 CCATCCTAGTGGATATAAAGTGG + Intergenic
1196249653 X:113445821-113445843 CCATCCTAGTGAGTGTGAAGTGG - Intergenic
1196438829 X:115700183-115700205 TCATCCCAGTAGATTTGAAGTGG - Intergenic
1196682166 X:118480549-118480571 CCATCCTAGTGGATGTGAAGTGG + Intergenic
1196701555 X:118674866-118674888 CCATCCTAGTGCATGTGAAGTGG + Intronic
1196972792 X:121127774-121127796 TCATCTTAGTAGATATAAAAAGG - Intergenic
1197415786 X:126171063-126171085 TCCTCTTAGAAAATATGGAGAGG - Intergenic
1197730890 X:129809020-129809042 CCATCTTAGTGAATGTGAAGTGG - Intronic
1197802318 X:130364063-130364085 CCATCCTAGTAGGTATGAAGTGG + Intronic
1198315117 X:135457508-135457530 CAATCCTAGTGAATGTGAAGTGG + Intergenic
1198769397 X:140113129-140113151 TCATTCTAGTGGGTATGAAGTGG + Intergenic
1199229057 X:145413858-145413880 TGTTCCTATTAAATATGAGGTGG + Intergenic
1199366440 X:146990475-146990497 CCATCCTAGTAGTTGTGAAGTGG - Intergenic
1199560170 X:149153127-149153149 TCATTCTAGTAAGTATGTAGTGG + Intergenic
1199757628 X:150880010-150880032 TCATCCTGGTAAGTGTGAAGTGG - Intronic
1199945996 X:152668339-152668361 CCATCCTAGTGGATGTGAAGTGG - Intergenic
1201386712 Y:13448163-13448185 TAATCCTAGAAAATATGAAGTGG + Intronic
1201540165 Y:15097227-15097249 TCATTGGAGTAGATATGAAGAGG - Intergenic