ID: 976409744

View in Genome Browser
Species Human (GRCh38)
Location 4:84699758-84699780
Sequence TATGAAGTGGTATCTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39657
Summary {0: 69, 1: 607, 2: 2780, 3: 20115, 4: 16086}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976409741_976409744 -1 Left 976409741 4:84699736-84699758 CCATTATGGTCATCCTAGTAAAT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409739_976409744 1 Left 976409739 4:84699734-84699756 CCCCATTATGGTCATCCTAGTAA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409734_976409744 8 Left 976409734 4:84699727-84699749 CCCCCCACCCCATTATGGTCATC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409738_976409744 4 Left 976409738 4:84699731-84699753 CCACCCCATTATGGTCATCCTAG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409736_976409744 6 Left 976409736 4:84699729-84699751 CCCCACCCCATTATGGTCATCCT 0: 1
1: 0
2: 0
3: 7
4: 133
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409740_976409744 0 Left 976409740 4:84699735-84699757 CCCATTATGGTCATCCTAGTAAA 0: 1
1: 0
2: 1
3: 11
4: 105
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409732_976409744 26 Left 976409732 4:84699709-84699731 CCTTGTTGTTTTTCAGTTCCCCC 0: 1
1: 0
2: 1
3: 17
4: 315
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409731_976409744 27 Left 976409731 4:84699708-84699730 CCCTTGTTGTTTTTCAGTTCCCC 0: 1
1: 0
2: 5
3: 33
4: 343
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409737_976409744 5 Left 976409737 4:84699730-84699752 CCCACCCCATTATGGTCATCCTA 0: 1
1: 0
2: 1
3: 2
4: 101
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086
976409735_976409744 7 Left 976409735 4:84699728-84699750 CCCCCACCCCATTATGGTCATCC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 976409744 4:84699758-84699780 TATGAAGTGGTATCTCATTGTGG 0: 69
1: 607
2: 2780
3: 20115
4: 16086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976409744 Original CRISPR TATGAAGTGGTATCTCATTG TGG Intronic
Too many off-targets to display for this crispr