ID: 976413776

View in Genome Browser
Species Human (GRCh38)
Location 4:84747623-84747645
Sequence CATGAGAGGGACACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3030
Summary {0: 2, 1: 10, 2: 119, 3: 963, 4: 1936}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976413764_976413776 26 Left 976413764 4:84747574-84747596 CCCCTACCAAATCTCATCTTGAA 0: 3
1: 240
2: 8626
3: 12205
4: 10683
Right 976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG 0: 2
1: 10
2: 119
3: 963
4: 1936
976413765_976413776 25 Left 976413765 4:84747575-84747597 CCCTACCAAATCTCATCTTGAAT 0: 7
1: 320
2: 9028
3: 12814
4: 12905
Right 976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG 0: 2
1: 10
2: 119
3: 963
4: 1936
976413767_976413776 20 Left 976413767 4:84747580-84747602 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG 0: 2
1: 10
2: 119
3: 963
4: 1936
976413768_976413776 -5 Left 976413768 4:84747605-84747627 CCCATAATCCCCACAAGTCATGA 0: 2
1: 44
2: 469
3: 1430
4: 3409
Right 976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG 0: 2
1: 10
2: 119
3: 963
4: 1936
976413769_976413776 -6 Left 976413769 4:84747606-84747628 CCATAATCCCCACAAGTCATGAG 0: 2
1: 35
2: 470
3: 1383
4: 2897
Right 976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG 0: 2
1: 10
2: 119
3: 963
4: 1936
976413766_976413776 24 Left 976413766 4:84747576-84747598 CCTACCAAATCTCATCTTGAATT 0: 217
1: 8669
2: 12013
3: 11176
4: 9172
Right 976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG 0: 2
1: 10
2: 119
3: 963
4: 1936

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976413776 Original CRISPR CATGAGAGGGACACAGTGGA AGG Intronic
Too many off-targets to display for this crispr