ID: 976416083

View in Genome Browser
Species Human (GRCh38)
Location 4:84777048-84777070
Sequence CTGTTTATACACAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976416080_976416083 -4 Left 976416080 4:84777029-84777051 CCTATATGACAATATCAGACTGT 0: 1
1: 0
2: 1
3: 18
4: 221
Right 976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976416083 Original CRISPR CTGTTTATACACAGGGAAGA AGG Intronic