ID: 976416083

View in Genome Browser
Species Human (GRCh38)
Location 4:84777048-84777070
Sequence CTGTTTATACACAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976416080_976416083 -4 Left 976416080 4:84777029-84777051 CCTATATGACAATATCAGACTGT 0: 1
1: 0
2: 1
3: 18
4: 221
Right 976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976416083 Original CRISPR CTGTTTATACACAGGGAAGA AGG Intronic
900984242 1:6064399-6064421 CTTTTTATAAATAGGGAAGGGGG + Intronic
902195916 1:14797977-14797999 CTCTTTGTACACTGGGAAGAAGG + Intronic
903044430 1:20554362-20554384 TTTTTTTTGCACAGGGAAGAAGG - Exonic
903406039 1:23097093-23097115 CTGTTTCCTCACAGGGAAGAAGG + Intronic
903684871 1:25123639-25123661 CTGCTTATCCACAGGGAGGAGGG - Intergenic
903779868 1:25814339-25814361 CTGTTTCTACACGGGGACAACGG - Intronic
903801026 1:25968315-25968337 CTGATTATACACAGGAAGGTGGG + Intronic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
907881302 1:58551357-58551379 CTGTTCGTACACGAGGAAGAGGG + Intergenic
909378496 1:74968611-74968633 CAGTTTATAAATAGGAAAGATGG - Intergenic
911382865 1:97137877-97137899 CTGCTTATAAACAGTGAATATGG - Intronic
911670592 1:100603526-100603548 CTGGTGATACCCAGGGAAAAGGG - Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
911942419 1:104064390-104064412 CTATTTATGCAAAAGGAAGAGGG + Intergenic
913067608 1:115270956-115270978 GTTTATGTACACAGGGAAGATGG - Intergenic
914229154 1:145749028-145749050 CTGTTTCTTCTCAGAGAAGAGGG - Intronic
917387498 1:174492869-174492891 CTGCTTATACATATGGAAGAGGG - Intronic
918036085 1:180873254-180873276 CTATTTTTACATGGGGAAGACGG - Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
919944883 1:202311883-202311905 GTGTTAATACATTGGGAAGAAGG - Intronic
921616771 1:217277600-217277622 CTGTTGACACACAGGGATTATGG - Intergenic
922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG + Intergenic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
922692009 1:227700467-227700489 CTGGTGATACACAGGCAAAAAGG + Intergenic
923588814 1:235300496-235300518 CTGTTTACAGATAGGGAAAATGG - Intronic
923726833 1:236513250-236513272 CTGTGTAAACACAGGGTAAATGG - Intergenic
1064671747 10:17722086-17722108 CTGCTGATACACAGGGAAACAGG - Intergenic
1068742544 10:60490458-60490480 CTGATTTTTCACAGGGAAGTAGG - Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1070528397 10:77314806-77314828 CTGTTTATTCACAGACGAGAGGG - Intronic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1072299326 10:94043889-94043911 CTTTTTATTCAGAGGAAAGAGGG + Intronic
1072374425 10:94800306-94800328 CTGGTTATACCCAGGCAAAAAGG - Intronic
1072738737 10:97896842-97896864 CTGTTCATACACTGGGGTGAGGG - Intronic
1073716076 10:106108877-106108899 CTCTTAATAAATAGGGAAGAGGG - Intergenic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075205709 10:120445922-120445944 CTGCTGATACACAGGCAAGCAGG + Intergenic
1075913843 10:126149051-126149073 CTGTCTCTTTACAGGGAAGAGGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1079968528 11:27007596-27007618 ATGGAAATACACAGGGAAGATGG + Intergenic
1081892796 11:46558110-46558132 CTGATGTTACACAGGGGAGAAGG + Intronic
1082170371 11:48997205-48997227 TTGTTAATACACAGGGACTAGGG - Intergenic
1088019139 11:105098105-105098127 CTATGTATACATATGGAAGAAGG + Intronic
1088142710 11:106636704-106636726 CTATTTGTACCCTGGGAAGAGGG - Intergenic
1088501552 11:110488363-110488385 CTATTTTTACACATGAAAGAAGG + Intergenic
1088694245 11:112353094-112353116 CTTGTTATGCACAGGGAAGTTGG - Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1091114435 11:132999968-132999990 GTGTGTCTACACAGGAAAGATGG - Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1092996590 12:13956926-13956948 CTGTTTATACACAGAAATTAAGG - Intronic
1094208959 12:27870405-27870427 GTGATTATGCACAGGCAAGAAGG + Intergenic
1094644855 12:32312503-32312525 CCGTTTATACACAGGGATAGTGG - Intronic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096676748 12:53230419-53230441 GTGTTTATACAGAGGGGAGGGGG - Intronic
1097247866 12:57616473-57616495 CTGTTTATCCAGTGGCAAGAGGG - Exonic
1097376621 12:58851128-58851150 CAGTTTATAGACTTGGAAGATGG - Intergenic
1098160257 12:67642835-67642857 CTGTTCATACACAGTAAAAATGG - Intergenic
1098267905 12:68741353-68741375 TTGCTTATACACATGGAAAATGG - Intronic
1099738281 12:86599053-86599075 CAGTTTATATGCAGTGAAGAAGG - Intronic
1103249015 12:119483999-119484021 CTTTTTATAAACAGAGAAAAAGG + Intronic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1104212625 12:126704425-126704447 CTTTGTTTACATAGGGAAGAGGG - Intergenic
1104469438 12:129017934-129017956 CTGTTTTTACTCAGGGTGGAGGG - Intergenic
1106209996 13:27633233-27633255 TTGTTTATACACACATAAGAAGG + Intronic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1107900359 13:45006571-45006593 CTGTTTATAAAGTGGGGAGAGGG - Intronic
1108023333 13:46151913-46151935 CTGTTTACATACAGATAAGATGG + Intronic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1108836786 13:54560288-54560310 CTATTTATACACAAGTATGAGGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1110849517 13:80229153-80229175 CTGTTTCTACTCATGGTAGAAGG + Intergenic
1111251044 13:85601756-85601778 CTGTGTGTACACTGTGAAGAGGG - Intergenic
1112608044 13:100927336-100927358 CTGAGTATAAACAAGGAAGAGGG + Intergenic
1112741885 13:102484289-102484311 CTGATTATACACAGGTCAGTAGG - Intergenic
1114230900 14:20781681-20781703 CTCTTTCTACACAGAAAAGATGG + Exonic
1114376103 14:22148329-22148351 CTGTTTAGAAACAGAGCAGAAGG - Intergenic
1114538625 14:23438627-23438649 TTGTTTGTGCACAGGGCAGAGGG + Intergenic
1117442369 14:55772014-55772036 CTCTTTGTACTCAGGGCAGAGGG + Intergenic
1118459602 14:65976241-65976263 CTGTCTATGCACAGGGGACAAGG + Intronic
1120319598 14:82942218-82942240 GCATTTATACACAAGGAAGATGG + Intergenic
1121149381 14:91617044-91617066 CTGCTTAAACATAGGGAATATGG - Intronic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1123625499 15:22224270-22224292 CAGTCTATTAACAGGGAAGACGG + Intergenic
1126844059 15:52742896-52742918 AGGTTGAGACACAGGGAAGAAGG - Intergenic
1127507381 15:59610290-59610312 CTGCTTATTCACAGGAAGGAAGG - Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1133475541 16:6118088-6118110 ATGTTAATACTCAGAGAAGATGG - Intronic
1134879094 16:17728617-17728639 CTGTGTATACACATGAAAGAGGG + Intergenic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137272477 16:46911276-46911298 CTATTTGGACACAGGGAACAAGG + Intronic
1137471145 16:48759552-48759574 CTGTTGATACCCAGGGAAACAGG + Intergenic
1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG + Intergenic
1138392764 16:56682426-56682448 CTCTTTATAGTCCGGGAAGAGGG - Exonic
1138705574 16:58911913-58911935 CTGTTCATACACAGAGAATCAGG - Intergenic
1139734165 16:68973034-68973056 CTGCTCATATTCAGGGAAGAAGG + Intronic
1140268408 16:73440797-73440819 GTGTTTATACACATGGGAGCTGG - Intergenic
1140380542 16:74483081-74483103 ACATTTATACACAGAGAAGATGG - Exonic
1142124503 16:88403482-88403504 CTGCTGAAACACAGGGCAGAGGG + Intergenic
1142483537 17:232796-232818 CTGTTTAGAGACAAGGAAGGGGG - Intronic
1142590543 17:1003677-1003699 CTGCTGATACACAGGTAGGATGG - Exonic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146380953 17:32327050-32327072 CTATTTATACACAAGGGAAAAGG + Intronic
1147564911 17:41530018-41530040 GTGATAATACACAGAGAAGAGGG - Intergenic
1148156162 17:45426240-45426262 CTGTTTGTACTCAGGGCAAATGG + Intronic
1150387831 17:64774858-64774880 CTGTTTGTACTCAGGGCAAATGG + Intergenic
1150830608 17:68515253-68515275 TTGTTTTTAAACAGGGAAGTGGG - Intronic
1150981115 17:70142602-70142624 CTGTGTTTCCACAGGGTAGAAGG - Intergenic
1151760819 17:76101792-76101814 CTGCTTGTGCACAGGGATGATGG + Exonic
1152257185 17:79246902-79246924 GAGTTAATACACAGGGCAGACGG + Intronic
1152590144 17:81207692-81207714 CTCTTGGTTCACAGGGAAGAGGG - Intronic
1155080787 18:22407942-22407964 ATGTTTGTAAACAGGGCAGAGGG - Intergenic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156083061 18:33363642-33363664 CTTAGTATACACAGTGAAGAAGG - Intronic
1156972659 18:43175506-43175528 CTGTTGAGACACAGCGAACAAGG + Intergenic
1158267731 18:55678640-55678662 CTTTTTATAGATAAGGAAGAGGG - Intergenic
1158495535 18:57951979-57952001 CTGGTTTTATACATGGAAGAGGG - Intergenic
1158564377 18:58542331-58542353 CTGTTTTTTCACAGAGAAGAAGG - Intronic
1158798591 18:60878565-60878587 GTGTATATACATAGAGAAGATGG + Intergenic
1159608133 18:70496283-70496305 CTATTTATTCTCAGTGAAGAGGG - Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1165138608 19:33686131-33686153 CTCTCTATACCCAGGGAAGCTGG - Intronic
1166603664 19:44120358-44120380 CTGTCTATTCACAGGCTAGAAGG + Intronic
1167969950 19:53183057-53183079 GACCTTATACACAGGGAAGATGG + Intronic
925476669 2:4224223-4224245 ATGATGATACACAGGGAAAAAGG - Intergenic
926008118 2:9388559-9388581 CTATATATTCACAGGGATGACGG - Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928930471 2:36618920-36618942 ATGTTTATACACAAGCAAGTAGG - Intronic
929132607 2:38593146-38593168 CTGTTTAACCATAGGAAAGACGG - Intronic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
930566662 2:53029027-53029049 CTGTCTATAAACCAGGAAGACGG + Intergenic
934907314 2:98216628-98216650 CTGTTTAGACTCAGAGCAGAGGG + Intronic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935358787 2:102229892-102229914 TTGTTTAGAAACAGGGAACAGGG + Intronic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
939247513 2:139645010-139645032 CTGTCTCTGCACAGGAAAGATGG + Intergenic
941540746 2:166781197-166781219 CTGCTTATTCACAGTGAGGAAGG - Intergenic
941616951 2:167731454-167731476 GTGTTCAAACACAGGAAAGAAGG - Intergenic
942344667 2:174989909-174989931 CTGTTTGTACCAGGGGAAGAAGG - Intronic
943456640 2:188116185-188116207 CTAGTTATACTCAGGGTAGAAGG - Intergenic
943983857 2:194594107-194594129 CTGTTTATTCCCAGGCAAGAGGG - Intergenic
944517623 2:200527994-200528016 GAGTTGATACAAAGGGAAGAAGG + Intronic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
946629218 2:221648069-221648091 CTGTCTTTAAACAGTGAAGACGG - Intergenic
947490413 2:230589936-230589958 GTGTTTATGCAAAGGAAAGAGGG + Intergenic
947759018 2:232589730-232589752 CTGGTTTTACACAGGAAAGCTGG - Intergenic
948149526 2:235733913-235733935 TTATTTATACACTGGGAAAAAGG - Intronic
948586760 2:239024635-239024657 CTGTTTGTTCACAGGGATGTGGG - Intergenic
1168761871 20:354830-354852 CTGTTTATTGAAAGGGAAGGTGG - Exonic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1172154533 20:32814576-32814598 CTATCTATACATAGGGAAGGAGG - Intergenic
1172263492 20:33590273-33590295 CTGTTTGTGCACAGGAAAAAAGG - Intronic
1173945274 20:46945371-46945393 CTGGTTAAACACAGGGAATTTGG - Intronic
1174178526 20:48659825-48659847 CTGGTTATGCACAGGGAAGGGGG - Intronic
1175256617 20:57651911-57651933 ATATTTATACACAGGGAGGTGGG + Exonic
1175785051 20:61707057-61707079 CTGTTTTATCCCAGGGAAGATGG - Intronic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178296992 21:31418384-31418406 CTGTTTAGACACAGGGTGGTGGG + Intronic
1178340630 21:31783158-31783180 ATGTTTTCACACAAGGAAGAGGG - Intergenic
1178405125 21:32317300-32317322 CTCTTTAAACACAGGGAATCAGG + Intronic
1182245831 22:28956800-28956822 CTGTTTATACCCAGGGCATGAGG - Intronic
1182757274 22:32690210-32690232 CTGTATCTCCACAGGGTAGAAGG - Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1184995264 22:48200918-48200940 ATGTTTATACAAAGGAAAGAAGG + Intergenic
949141783 3:642508-642530 CTGTTTATACAAAGACAGGATGG + Intergenic
950797071 3:15518912-15518934 CTGTGTATACACAGAAAATAAGG - Intronic
951033991 3:17913058-17913080 GTTTTTATAAACAGTGAAGAAGG + Intronic
951532564 3:23711516-23711538 CTCTTTATCCACAGAGAAGCTGG + Intergenic
951811546 3:26706122-26706144 CTGTTTCTTCACATGGCAGAAGG + Intronic
952073048 3:29662323-29662345 CTGTTTATAGACACTGAAAAGGG + Intronic
955326857 3:58015187-58015209 CATTTTATAGACAGGGAAGCAGG - Intronic
958721444 3:97848852-97848874 CTATTTATACACAGGGTTGCAGG - Intronic
962124759 3:132605191-132605213 ATGTGTAGACACAGGGAATATGG - Exonic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962408926 3:135124314-135124336 CTGATGATACACAGAGAAGGAGG - Intronic
962604596 3:137023188-137023210 CTGTTCTTTCTCAGGGAAGAAGG + Intergenic
963081729 3:141401651-141401673 CTGTCAAAACACAGGGAACATGG + Intronic
963281219 3:143386268-143386290 CTGTTTATACCCAGGCATGCAGG + Intronic
963401640 3:144806296-144806318 CTGATGATACCCAGGCAAGAAGG - Intergenic
964394278 3:156229018-156229040 CCCTTTACACACAAGGAAGAGGG - Intronic
965276295 3:166686959-166686981 CTGGTTATACACTGAGAAAATGG - Intergenic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
974706537 4:65524539-65524561 CTGTTTCTAAACAGGGATGTTGG - Intronic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
978521163 4:109616726-109616748 ATGCTTGTACACAGAGAAGATGG - Intronic
980275984 4:130651212-130651234 CTGTTGATACACAGGCAAACAGG + Intergenic
981833331 4:149027326-149027348 CTGTATATACACAGAGAATAAGG - Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
983458728 4:167999760-167999782 TTGATTATACACAGGGACCAGGG - Intergenic
985009643 4:185569220-185569242 CTGTTGATAAACAGAGAACAAGG - Intergenic
989238827 5:39180221-39180243 CCGTTAATACACTAGGAAGAAGG - Intronic
990206014 5:53430317-53430339 CAGTTTTTACACAGGAAAGTGGG - Intergenic
990768723 5:59218252-59218274 CTGTTCATGCACAGGAAGGAGGG - Intronic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994540439 5:101089304-101089326 CTCTACATACACAGGGAAGTAGG + Intergenic
996289608 5:121836271-121836293 CACTTTATACAGAGGGAAAAAGG + Intergenic
996402403 5:123076586-123076608 CTGTTTCCACTCAGGGCAGAAGG + Intergenic
998102467 5:139445635-139445657 CTGTTAATACACAGGAGAAATGG + Intergenic
1000125994 5:158244784-158244806 CTGATTATACACAAGGATGCAGG + Intergenic
1001239183 5:170055393-170055415 CTCGTTGTCCACAGGGAAGAAGG + Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1004465666 6:15882796-15882818 CTCTTTATACACAGGTTATAGGG + Intergenic
1004969793 6:20897117-20897139 CTGTTTATTCACATGACAGAAGG + Intronic
1005209450 6:23443546-23443568 TTATATATACACAGGCAAGAGGG + Intergenic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG + Intronic
1014916969 6:127162442-127162464 CTGTTTTTACAAAGGAAGGAAGG - Intronic
1015062956 6:128989863-128989885 CTGTCTATAAACAGGAAAGCAGG - Intronic
1018640225 6:165898217-165898239 CTGTTTTTACACTGAGAAGGTGG + Intronic
1019924723 7:4184629-4184651 CTGTTTAAACTCAGAGAGGAAGG + Intronic
1020281092 7:6650460-6650482 CTGTTTTTTCACAGTGAAGCCGG + Intronic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1021996246 7:26180550-26180572 CTGTGAATACTCAGGGAAGTGGG - Intronic
1025725513 7:64054484-64054506 ATGTTTATTCACAGGGCAAAGGG - Intronic
1026539429 7:71267506-71267528 CTGAAAATACACAGGCAAGAAGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028818101 7:95172310-95172332 CTCTTTATTCACAGGCAATATGG + Intronic
1031221622 7:118973806-118973828 CTGTCTATAAACCAGGAAGAGGG + Intergenic
1032977038 7:137237272-137237294 CTGTCTATAAACCAGGAAGAGGG + Intronic
1033021092 7:137725032-137725054 CTCTTTATACAGAGGTGAGAAGG + Intronic
1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG + Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1038072895 8:24037043-24037065 CTGGATATACACTGGGAAGTGGG + Intergenic
1038425101 8:27459788-27459810 CTCTTTATTCACATGCAAGATGG + Exonic
1040544757 8:48390217-48390239 CAGTTTCTAGACAGGAAAGAAGG + Intergenic
1041716929 8:60940983-60941005 CTGTTTATAAACCAGGAAGTGGG - Intergenic
1042892893 8:73633012-73633034 CTGCTTATACACAGGGAAAAAGG + Intronic
1043124457 8:76372591-76372613 CTTTTCATACAGAGGTAAGAAGG - Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1046019459 8:108647155-108647177 CTGTTAATACATAAGGCAGAAGG - Intronic
1046699742 8:117386768-117386790 TTGTTGATCCAAAGGGAAGATGG - Intergenic
1048658441 8:136570220-136570242 CTGTTTATCCTCAGAGAAGTAGG - Intergenic
1048896259 8:138995118-138995140 CTGTTTATTCACAGGTATAAAGG + Intergenic
1049777681 8:144414064-144414086 CTGCATACACACAGCGAAGAGGG - Exonic
1050990952 9:12151303-12151325 CTTTTTCTTCACATGGAAGAAGG + Intergenic
1051452931 9:17217205-17217227 ATCTTTATACACATGGCAGAAGG + Intronic
1051595443 9:18820116-18820138 CTCGTAATAGACAGGGAAGAGGG + Intronic
1051713434 9:19956911-19956933 CTGTCTATACACCAGGAAGTAGG + Intergenic
1052512265 9:29436814-29436836 CTGTTTCTGCACTGGGCAGATGG + Intergenic
1053420285 9:37973191-37973213 CTGTTTATAATCATGGAAAATGG - Intronic
1055227888 9:74022739-74022761 CTGTCCATACTCAGAGAAGAGGG - Intergenic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1056816202 9:89802998-89803020 GTATTTTCACACAGGGAAGATGG - Intergenic
1057246221 9:93456620-93456642 CTGTTTTTACACATGAAAAATGG - Intronic
1058113645 9:101059240-101059262 TTGTTTATACACACTCAAGAAGG + Intronic
1058377609 9:104341634-104341656 CTGTTTCCTCACAGGGCAGAAGG - Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1060160739 9:121360928-121360950 CAGTGTATACACTGGGAAAATGG + Intronic
1060582747 9:124766532-124766554 CTGTTTTTACACATGAAATAAGG + Intronic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1185458653 X:323360-323382 CAGTCTATTAACAGGGAAGACGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186261889 X:7789009-7789031 CTGCTTATACTCATGGTAGAAGG - Intergenic
1186314963 X:8359318-8359340 CTGTATCTTCACAGGGCAGAAGG - Intergenic
1186758625 X:12700041-12700063 CAGTCTTTACACAGGGCAGAGGG + Intronic
1186798339 X:13067792-13067814 CTGTTTATTCTCAAGGATGAAGG + Intergenic
1189249485 X:39589000-39589022 CTGATTATACACAGCAAGGAGGG + Intergenic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1191108617 X:56788247-56788269 CTCTTTATTCACATGGGAGAAGG + Intergenic
1194159732 X:90435930-90435952 CTGTGTATATACTGTGAAGAGGG + Intergenic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1197658551 X:129144977-129144999 CAATGTATACACAGGAAAGATGG + Intergenic
1197717646 X:129720836-129720858 CTGCTGACACACAGTGAAGAGGG - Intergenic
1198306216 X:135385731-135385753 CTATTTACAAACAAGGAAGATGG - Intergenic
1199275149 X:145932551-145932573 CTGTTTACAGACAGAGAAAATGG - Intergenic
1200506034 Y:4012896-4012918 CTGTGTATATACTGTGAAGAGGG + Intergenic