ID: 976416083 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:84777048-84777070 |
Sequence | CTGTTTATACACAGGGAAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 282 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 21, 4: 259} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
976416080_976416083 | -4 | Left | 976416080 | 4:84777029-84777051 | CCTATATGACAATATCAGACTGT | 0: 1 1: 0 2: 1 3: 18 4: 221 |
||
Right | 976416083 | 4:84777048-84777070 | CTGTTTATACACAGGGAAGAAGG | 0: 1 1: 0 2: 1 3: 21 4: 259 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
976416083 | Original CRISPR | CTGTTTATACACAGGGAAGA AGG | Intronic | ||