ID: 976418681

View in Genome Browser
Species Human (GRCh38)
Location 4:84811549-84811571
Sequence CATGATTAAGTGCAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976418681_976418688 26 Left 976418681 4:84811549-84811571 CCCTACTCCTGCACTTAATCATG 0: 1
1: 0
2: 1
3: 4
4: 140
Right 976418688 4:84811598-84811620 AATCTTTTTCATGGATACAGTGG 0: 1
1: 0
2: 0
3: 22
4: 279
976418681_976418687 17 Left 976418681 4:84811549-84811571 CCCTACTCCTGCACTTAATCATG 0: 1
1: 0
2: 1
3: 4
4: 140
Right 976418687 4:84811589-84811611 GCAAGCTGAAATCTTTTTCATGG 0: 1
1: 0
2: 4
3: 22
4: 285
976418681_976418689 27 Left 976418681 4:84811549-84811571 CCCTACTCCTGCACTTAATCATG 0: 1
1: 0
2: 1
3: 4
4: 140
Right 976418689 4:84811599-84811621 ATCTTTTTCATGGATACAGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976418681 Original CRISPR CATGATTAAGTGCAGGAGTA GGG (reversed) Intronic
900001944 1:19333-19355 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
900021664 1:189856-189878 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
904384851 1:30134581-30134603 CAGGATTCAGGGCAGGAGCAGGG - Intergenic
906549634 1:46653106-46653128 CATGAGTAAGTGTAAGATTAAGG - Intronic
907729561 1:57052919-57052941 CATGATTAAGGGGAAGAGCACGG - Intronic
907957281 1:59241855-59241877 GATGATGAAGGGAAGGAGTAAGG + Intergenic
908517252 1:64905728-64905750 CATGACTAAATATAGGAGTAAGG - Intronic
908868892 1:68584862-68584884 CTTGATAAAGAGCAGGAGAAAGG - Intergenic
913283254 1:117205494-117205516 GATGAATGAGTGCAGGAGTAAGG - Intronic
914382487 1:147130065-147130087 CACGGCTAAGTGCAGGAGCAAGG - Intergenic
914825538 1:151136139-151136161 CAGGATCCTGTGCAGGAGTAGGG - Exonic
918386611 1:184014354-184014376 CATGATTGAATGCAGCAGAAAGG + Intronic
918590143 1:186231944-186231966 CATGGCTAAAGGCAGGAGTAAGG - Intergenic
918876038 1:190044947-190044969 GATGTTTAAGGGCAGGAGTGCGG - Intergenic
922021482 1:221709386-221709408 CATGCTTATGTGCAAAAGTATGG + Intronic
924264086 1:242263160-242263182 AAAGATTTAGTGCAGGTGTAAGG - Intronic
1064156590 10:12907887-12907909 CCTGGGTAAGTGCAGGAGAAGGG + Intronic
1064835985 10:19531318-19531340 CATGATTGATCCCAGGAGTATGG + Exonic
1066720712 10:38335304-38335326 AAAGATTTAGTGCAGGTGTAAGG + Intergenic
1068411759 10:56664464-56664486 CTTGATTAAGTAAAGGAGTTAGG - Intergenic
1072237231 10:93463818-93463840 CAGGATGAAGTGCAGGGGTGTGG - Intronic
1073206341 10:101771305-101771327 CACGATTGGGTGCAGGAGTGAGG - Intronic
1074972667 10:118551958-118551980 CAGGATTGGGAGCAGGAGTAGGG + Intergenic
1079112717 11:17613792-17613814 CATGATTCAGGGCAGGGGTGGGG + Intronic
1086219363 11:84423216-84423238 CATGTTTAAGTGAAGAATTATGG - Intronic
1086432608 11:86749698-86749720 CATGATAGAGTGAAGGAGAAGGG + Intergenic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1091682506 12:2537137-2537159 CATCACTAAGTGGAGGAGGAGGG - Intronic
1092998020 12:13968839-13968861 AATGGTTAAGTGCAAGAGAATGG - Intronic
1094012443 12:25823566-25823588 CAGGGTGAAGTGCAGTAGTATGG - Intergenic
1099122174 12:78704490-78704512 CATGATTAACTGCATGACTTGGG + Intergenic
1099765560 12:86978654-86978676 CATGATTAACTGAAGGAAAATGG + Intergenic
1099970215 12:89492661-89492683 CAGGATGAGGTGCAGGTGTATGG - Intronic
1101569786 12:105943137-105943159 CATGAATAAGTGCTTTAGTAGGG + Intergenic
1105237366 13:18570552-18570574 CATGCTAAAGTGCTGAAGTATGG + Intergenic
1106005712 13:25768551-25768573 CATGATAAAGTGCAGAAAGAAGG - Intronic
1106189636 13:27439815-27439837 CAGGAGTAAGTGCAGGATAAAGG + Intronic
1109124090 13:58497397-58497419 AATTATTAAGTGCAGGGGTCAGG - Intergenic
1109878423 13:68436972-68436994 CATTATCAAATGCAGCAGTATGG - Intergenic
1110140820 13:72127140-72127162 CATGATCAAGAGCTGGTGTATGG + Intergenic
1120191954 14:81447620-81447642 AATGATTAAGTGAATGAGTCAGG - Intergenic
1131706284 15:94999742-94999764 CAGGATTCAGTGCAGGTGAAGGG + Intergenic
1132451566 15:101971606-101971628 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
1132455324 16:19022-19044 CATGAGGAAGGGCAGGAGGAGGG + Exonic
1136634258 16:31509329-31509351 CAGGATTAAGTCCACGAGGAAGG - Intergenic
1139266612 16:65645727-65645749 TATGGATAAGTGAAGGAGTATGG - Intergenic
1139329534 16:66176642-66176664 CATGATGAAGTGATGGAGGAAGG + Intergenic
1140902958 16:79386672-79386694 CATGATGATGTAAAGGAGTAGGG + Intergenic
1145025589 17:19465741-19465763 CCTGATTAAGTGTAGGAATCAGG + Intergenic
1146057359 17:29588192-29588214 CATGATTAAGAGTGAGAGTATGG - Intronic
1150252871 17:63718463-63718485 CAAGAATATGTGCAGGAGTTAGG - Intronic
1150696688 17:67411534-67411556 CATGAGTGAGGGCAGGAGAAAGG + Intronic
1155445303 18:25905364-25905386 CATGAGATAGTGCAGCAGTAAGG - Intergenic
1158552392 18:58447005-58447027 CATGAATAGGTGCATGAATAGGG + Intergenic
1160553648 18:79712324-79712346 CAGGCTTAAGTGCAGTAGTGTGG + Intronic
1160633696 19:60941-60963 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
1162377334 19:10312472-10312494 CAAGACTAAGTGAAGGAGTTTGG - Intronic
1166025505 19:40080510-40080532 CAAGATTATGTGCAGCAATATGG + Intronic
927466184 2:23338596-23338618 GATGGTAGAGTGCAGGAGTAAGG - Intergenic
928070539 2:28210643-28210665 CATTATAAAATGCAGGAGAAAGG + Intronic
928303097 2:30144352-30144374 GATGATGATGTGCAGAAGTAAGG - Intergenic
929747817 2:44677201-44677223 CATGATTAAGAGCAGTCGGAGGG + Intronic
930607363 2:53506284-53506306 CATGAATCACTGCAGGAGTGGGG + Intergenic
932118839 2:69079313-69079335 CATGATTAATAGCAGGACTGGGG + Intronic
936567778 2:113594072-113594094 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
938512409 2:131963950-131963972 CATGCTAAAGTGCTGAAGTATGG - Intergenic
942999101 2:182301955-182301977 TAGGATTAATTGCAGCAGTAAGG + Intronic
944443346 2:199764600-199764622 TCTGAGTAAGTGCAGGAGTCAGG + Intronic
945306854 2:208266703-208266725 CCTAATTAAGTTCAGGCGTAAGG - Intronic
946767007 2:223050232-223050254 CAGGACTAATTGCAGGAGTCAGG - Intergenic
1168918384 20:1510209-1510231 CATGATTAAGCTCATGGGTAGGG + Intergenic
1170897319 20:20427439-20427461 CATGAATAAGTGCAGGACGCAGG - Intronic
1171275347 20:23852122-23852144 CATGACTAAGCACAGGAGTGAGG - Intergenic
1172610545 20:36248260-36248282 CATGACTCAGTGCGGGAGTCAGG - Intronic
1173636927 20:44567734-44567756 CAGGATTAAGAACAGGAGCAGGG + Intronic
1176744607 21:10640305-10640327 CATGTGTAGGTGCAGGAGTCAGG - Intergenic
1176781353 21:13198834-13198856 CATGCTAAAGTGCTGAAGTATGG + Intergenic
1177979050 21:27887971-27887993 CATGCTAAAGTGCTGAAGTATGG + Intergenic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182466439 22:30519798-30519820 CAAGATTAATTTCAGGAGCAGGG + Intergenic
1184764481 22:46564392-46564414 CCTGTTAAAGTGCAGGGGTAGGG - Intergenic
955886690 3:63606796-63606818 AATGAATAAGTGGAGGAGCAAGG - Intronic
957816413 3:85304254-85304276 CTTGATTACATGAAGGAGTACGG - Intronic
957895321 3:86413892-86413914 CATAATGAAGTGAAAGAGTATGG + Intergenic
958989969 3:100831536-100831558 CATGATCCTGTGCAGAAGTAGGG + Intronic
962887011 3:139637120-139637142 CTTGATTAAGTGTATGAGTCAGG + Intronic
964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG + Intronic
965993941 3:174855364-174855386 CATTATTCAGTGCATGACTATGG + Intronic
970590640 4:17557430-17557452 CAAGCTGAAGTGCAGTAGTATGG + Intergenic
971598363 4:28560785-28560807 AATGATTAAGAATAGGAGTAAGG + Intergenic
972721716 4:41706217-41706239 CAGGATTTGGTGCAGGAGGAAGG + Intergenic
974126025 4:57696769-57696791 GATGATTTAGTGCAGTAGAATGG + Intergenic
974232599 4:59136270-59136292 CATGAAGAAGTGGAGTAGTATGG - Intergenic
976418681 4:84811549-84811571 CATGATTAAGTGCAGGAGTAGGG - Intronic
979322239 4:119337862-119337884 CATGATTAATTGCACAAGTCAGG + Intergenic
981648469 4:147027471-147027493 CATGATTAAGTGAAGCACCAAGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983527420 4:168773399-168773421 CATGATTAAATAAAGGAGCATGG - Intronic
984720619 4:182969773-182969795 GAAGATTAAGTGGAGGAGCATGG - Intergenic
988999648 5:36746769-36746791 CATGATTAAGTGCCTAGGTAAGG - Intergenic
990455499 5:55982735-55982757 AATTAGTAAGTGAAGGAGTAGGG + Exonic
990734909 5:58849673-58849695 CATGAATAACTGCAGGATTGGGG - Intronic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992169772 5:74090091-74090113 TATGACTAAGTGCAGGATGAAGG - Intergenic
992376883 5:76197059-76197081 CATGATAATGGGCAGGAGTAGGG - Intronic
992608834 5:78489957-78489979 CCTGATTAAATGCAAGAGCAAGG + Intronic
996603939 5:125298540-125298562 CCAGATTAAGTGCAGGTATAAGG - Intergenic
998485779 5:142500623-142500645 CATGATTATGTGGAGTATTAGGG + Intergenic
1001803201 5:174561058-174561080 AATGAGTACGTGGAGGAGTAAGG - Intergenic
1002117540 5:176975095-176975117 CAGGCTTAAGTGTAGGGGTATGG - Intronic
1002481793 5:179506195-179506217 CATGCTTCAGTGCAGGATGAGGG + Intergenic
1003471863 6:6443690-6443712 CATGGTTCAGTTCAGGTGTAAGG - Intergenic
1004270912 6:14194305-14194327 TATGTTTAAGTGCTGGAATAAGG + Intergenic
1005951101 6:30631914-30631936 CATGAGTCAGCGGAGGAGTATGG + Intronic
1009286482 6:61825380-61825402 CATGATTAGATGCAGAATTATGG - Intronic
1009731716 6:67616508-67616530 CATGTTTCACTGCAAGAGTAGGG - Intergenic
1010414773 6:75601033-75601055 CATGATTAAGTGCAGTCTTTGGG - Intergenic
1010545354 6:77148623-77148645 CATGATCCAGTGACGGAGTATGG - Intergenic
1010733592 6:79416561-79416583 AAAGCTTAAGGGCAGGAGTAAGG + Intergenic
1011196208 6:84782173-84782195 CATGAGGAAGTACAAGAGTAAGG - Intergenic
1016004018 6:139070869-139070891 CATGATGAAGTGAGGGATTAAGG + Intergenic
1016520377 6:144940123-144940145 CATGTTTGAGTGCAGGAGAAGGG + Intergenic
1016722249 6:147313971-147313993 CAGAATAAAGTGCAGGAATAAGG - Exonic
1017408290 6:154142697-154142719 CAAGTTTCAGAGCAGGAGTAAGG - Intronic
1022431571 7:30328011-30328033 TATGAGTAAGTGAAGGAGAAAGG + Intronic
1022470162 7:30677092-30677114 CAAGATGAGGTGCAGGAGGAGGG + Intronic
1029026358 7:97421007-97421029 CAGGAGTAAGTGCAGGTGTCTGG + Intergenic
1030214883 7:107034363-107034385 TTTGATTAAGTTGAGGAGTATGG - Intergenic
1032545524 7:132738482-132738504 CCTGATTAAGTCCAGGAGGATGG - Intergenic
1038729291 8:30112948-30112970 TAAGATTCGGTGCAGGAGTAGGG - Intronic
1044503766 8:92992489-92992511 CTTGAATCAGTGCAGGAGTTTGG - Intronic
1045401458 8:101822953-101822975 CTTGATTAATTGCATCAGTAAGG - Intronic
1049884752 9:19446-19468 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
1050900956 9:10948035-10948057 CATGATTACCTCCAGGAGAAAGG + Intergenic
1051372705 9:16371944-16371966 CATTTTGAAGTGCTGGAGTATGG + Intergenic
1056561438 9:87733412-87733434 CATGGGTAAGTGCAGCACTAGGG + Intergenic
1060255248 9:122021719-122021741 CAAGAATATGTGCAGGAATATGG + Intronic
1060437960 9:123611630-123611652 CATGATTAAATGTAGGAGATGGG - Intronic
1061280117 9:129593139-129593161 CATGATGAAGTTCAGGAGTAGGG + Intergenic
1186338901 X:8622299-8622321 CTTGCTTAACTACAGGAGTATGG + Intronic
1188078944 X:25812827-25812849 CATAAATAAGTGCAAGTGTAGGG - Intergenic
1190411552 X:50141424-50141446 CATGAGAAAGTGCAGGAAAAGGG + Intergenic
1191732943 X:64356930-64356952 CAGGATTAAGTTCTGGAATAAGG + Intronic
1191907649 X:66110754-66110776 CATGATTGAATACTGGAGTAAGG + Intergenic
1193671242 X:84389377-84389399 CCTGAGTCAGGGCAGGAGTAGGG - Intronic
1200401056 X:156020706-156020728 CATGAGGAAGGGCAGGAGGAGGG - Intergenic