ID: 976419968

View in Genome Browser
Species Human (GRCh38)
Location 4:84830698-84830720
Sequence CATGCAGCATAGATGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976419968_976419972 30 Left 976419968 4:84830698-84830720 CCTAATTCCATCTATGCTGCATG 0: 1
1: 0
2: 1
3: 6
4: 148
Right 976419972 4:84830751-84830773 TCTTCAGAAAGACTGGTTACAGG 0: 1
1: 0
2: 0
3: 14
4: 137
976419968_976419971 23 Left 976419968 4:84830698-84830720 CCTAATTCCATCTATGCTGCATG 0: 1
1: 0
2: 1
3: 6
4: 148
Right 976419971 4:84830744-84830766 TGCAATATCTTCAGAAAGACTGG 0: 1
1: 0
2: 2
3: 24
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976419968 Original CRISPR CATGCAGCATAGATGGAATT AGG (reversed) Intronic
904906395 1:33900285-33900307 CATGGAGCATAGATAGCATTTGG - Intronic
905412795 1:37783314-37783336 CAGGCAGAACAGATTGAATTTGG + Intergenic
905842723 1:41197952-41197974 CATGCAGTACAGATGGGCTTTGG + Intronic
906649417 1:47502110-47502132 GTAGCAGCATAGATGGAATATGG + Intergenic
907443862 1:54495069-54495091 CATTTAGCAGAGATGGTATTGGG + Intergenic
913548042 1:119889085-119889107 CTTGCAGACTAGAAGGAATTGGG + Intergenic
918143485 1:181736949-181736971 GATTCAGGAAAGATGGAATTTGG + Intronic
918145923 1:181755778-181755800 CATGGAGCAAAAATGGGATTTGG - Intronic
918632928 1:186740342-186740364 CATGACGAAGAGATGGAATTAGG - Intergenic
918854045 1:189727942-189727964 CCTGCAGCATAGTTTGAAGTTGG + Intergenic
920309024 1:205037614-205037636 CAGGCAGCATAAATAGACTTTGG + Intergenic
921815867 1:219562715-219562737 CATGCATCATAGAAGGAACTGGG + Intergenic
1063442748 10:6086349-6086371 TATGCAGCATGGATGGAACCGGG - Intergenic
1068036817 10:51770280-51770302 TATGCAGCATAGAGGGAAAGTGG + Intronic
1069413553 10:68177427-68177449 CAAGCTGCATAAATGAAATTTGG + Intronic
1069701285 10:70428324-70428346 CATTCAGAATGGATGGAACTGGG - Exonic
1071256182 10:83873835-83873857 CATGCAGTCTAGATGGCACTGGG - Intergenic
1074944929 10:118272128-118272150 CGGGCAGCATAGATTTAATTGGG - Intergenic
1076575497 10:131464106-131464128 AATGCAGCAAAGAAGGGATTTGG + Intergenic
1077358919 11:2131150-2131172 CATGGTGGAAAGATGGAATTAGG + Intronic
1078073949 11:8140161-8140183 GATGCATCATAGGTGGAAATCGG + Exonic
1082710042 11:56543625-56543647 CATGTAGCATGAATAGAATTAGG - Intergenic
1084710786 11:70842684-70842706 CGTGCAGCTTAAATGGAACTCGG + Intronic
1093270912 12:17060170-17060192 CAAGCACTATAGATGGCATTGGG + Intergenic
1095878291 12:47105491-47105513 CATGCAGCATTGGTAGAAATGGG + Intronic
1096034373 12:48452071-48452093 CCTGCAGTATAGTTTGAATTTGG - Intergenic
1098068878 12:66650257-66650279 CAGGTGGCATAGATGGACTTGGG - Intronic
1099066753 12:77990287-77990309 CATGCAGAAAAGCAGGAATTAGG + Intronic
1099801126 12:87457591-87457613 GCAGCAGCATAGATGGAACTGGG + Intergenic
1100468662 12:94872161-94872183 CATGCAGCAGAAATGGAAACTGG - Intergenic
1101522449 12:105496493-105496515 CATGTAGCATTGAGGGATTTGGG + Intergenic
1101525030 12:105520854-105520876 CTTGAAGGATAGATGGGATTTGG - Intergenic
1105666308 13:22560885-22560907 CAAGAAGGATAGGTGGAATTAGG - Intergenic
1106197522 13:27507159-27507181 CATGAAAGATAAATGGAATTAGG + Intergenic
1110591319 13:77264641-77264663 CATGCAGTATTGATGAAATATGG - Intronic
1111066792 13:83104690-83104712 CAAGCAGCATAGATGAATCTGGG - Intergenic
1111516281 13:89336007-89336029 CATGCAGAAGAGAGTGAATTTGG + Intergenic
1111584335 13:90264391-90264413 CATTCAGCATACATTGAATAGGG - Intergenic
1111870394 13:93824910-93824932 CAGGCACCATACATGGAAATGGG + Intronic
1112133657 13:96552092-96552114 CATGCATTAAAAATGGAATTTGG + Intronic
1112632173 13:101173652-101173674 AACGGAGCAAAGATGGAATTTGG + Intronic
1114745420 14:25140962-25140984 CTTGCAGGATGGATTGAATTTGG - Intergenic
1118426348 14:65667760-65667782 CTTGCAGTATAGTTTGAATTCGG - Intronic
1121948378 14:98145612-98145634 CATGCAGAAAATTTGGAATTAGG + Intergenic
1122798734 14:104219433-104219455 TAAGCAGCAAAGCTGGAATTCGG + Intergenic
1127519970 15:59734133-59734155 GATGAAGAACAGATGGAATTGGG + Intergenic
1128992325 15:72271649-72271671 CATGAAGATTAGATGTAATTAGG - Intronic
1129640325 15:77370235-77370257 CATGAAGGATGGAAGGAATTTGG - Intronic
1132109497 15:99092140-99092162 CTTGAAGTATAGATGGATTTAGG + Intergenic
1134435746 16:14254781-14254803 CATGCATCATACAAAGAATTGGG + Intronic
1135418162 16:22284984-22285006 CATGCTTAAAAGATGGAATTCGG - Exonic
1140801631 16:78493757-78493779 CATACAGAAGAGATGGAACTAGG + Intronic
1141824408 16:86468793-86468815 AATGCAGCAGAGAGGGAGTTAGG + Intergenic
1144157660 17:12522643-12522665 CACGCAGCATGGATGGTGTTAGG - Intergenic
1146642523 17:34552010-34552032 CATGCAGCTTATATTGCATTGGG - Intergenic
1147438366 17:40431680-40431702 CATGCAGTAGAGATGGAAGCAGG + Intergenic
1150837453 17:68577252-68577274 CATGCAGAATAGAGGGGAATTGG - Intronic
1150957718 17:69879297-69879319 CAGCCAGCAAAGATGGAGTTTGG + Intergenic
1155468623 18:26167480-26167502 CATGTGTTATAGATGGAATTGGG + Intronic
1157385856 18:47259789-47259811 CATGCAAATTAGTTGGAATTGGG + Intergenic
1157400872 18:47385783-47385805 CCAGCAGCATTGATGGAATAGGG + Intergenic
1159198441 18:65149653-65149675 CATGCAGAAAAGCAGGAATTAGG + Intergenic
1160507067 18:79433084-79433106 CTTGCAGCAATCATGGAATTTGG + Intronic
1161419882 19:4170978-4171000 CTTGAAGAATGGATGGAATTTGG + Intronic
1166072660 19:40395959-40395981 CAGGCAGAAGGGATGGAATTTGG - Exonic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
927016400 2:18966988-18967010 CATGTAGGATAGTTGGAAGTAGG + Intergenic
931823540 2:65976403-65976425 CATCCTGCATAGAAGTAATTTGG + Intergenic
932026657 2:68140475-68140497 TATGCAGAATACATAGAATTTGG - Intronic
933597793 2:84300272-84300294 CATACAGCAAAGGAGGAATTTGG - Intergenic
933597803 2:84300359-84300381 CATACAGCAAAGGAGGAATTTGG - Intergenic
933597813 2:84300446-84300468 CATACAGCAAAGGAGGAATTTGG - Intergenic
933597825 2:84300533-84300555 CATACAGCAAAGGAGGAATTTGG - Intergenic
935541498 2:104354122-104354144 CATGTGGCATAGATGGGACTTGG + Intergenic
937521415 2:122717224-122717246 CCTATAGCATAGATTGAATTTGG - Intergenic
939146155 2:138417382-138417404 CCTGAAGTATAGATAGAATTGGG - Intergenic
940831039 2:158466290-158466312 CATGCAGGATAAATGGTATCAGG - Intronic
941293597 2:163707489-163707511 AATGCAGAAGAGATGGAATTTGG + Intronic
943902726 2:193461964-193461986 CAGGCAGCATAAATTGCATTTGG - Intergenic
947483112 2:230521468-230521490 CATGCAGCAAACTAGGAATTAGG - Intronic
947780250 2:232753786-232753808 CATGGAGCATACTTGTAATTAGG - Intronic
948432405 2:237928104-237928126 CATGCAGGAAAGCAGGAATTAGG + Intergenic
1179293921 21:40043850-40043872 CCTGCAGAATAGATGCAGTTTGG + Intronic
950747692 3:15103401-15103423 TATGCAGCATAGTTGGGAGTAGG - Intergenic
952925345 3:38315943-38315965 CAAGCAGCAGAGCTGGGATTTGG + Intronic
956985622 3:74696460-74696482 CATACATCACAAATGGAATTGGG - Intergenic
959460815 3:106623363-106623385 CATGCAGGATACATGGCAATTGG - Intergenic
960551458 3:118980771-118980793 AATGGAGCATACATGAAATTCGG - Intronic
961952874 3:130769112-130769134 CATTCACAATAGCTGGAATTTGG + Intergenic
967380065 3:188847918-188847940 CATGAAGCAGAGCTGGAACTAGG + Intronic
974250777 4:59379992-59380014 CCTGCAGCATAGTTTGAAGTTGG - Intergenic
976419968 4:84830698-84830720 CATGCAGCATAGATGGAATTAGG - Intronic
979069300 4:116181131-116181153 CATTCAACATATATTGAATTAGG + Intergenic
979809917 4:125024411-125024433 GATGCAGGGTAGATGGAATGGGG + Intergenic
984222272 4:176992884-176992906 CATGTACCATTGATGGCATTTGG + Intergenic
987179062 5:15347463-15347485 CAAACATCATATATGGAATTGGG + Intergenic
991427723 5:66508911-66508933 CATCCAGAATAGAGTGAATTCGG - Intergenic
993286663 5:86007993-86008015 CATGCAGTATAGTTTGAAGTTGG + Intergenic
993434522 5:87875183-87875205 TATGCTACATAGTTGGAATTGGG + Intergenic
993671192 5:90763821-90763843 GAAGCAACATAGATGCAATTAGG - Intronic
993958081 5:94261896-94261918 CATGGAGAATAGATTGAATCAGG - Intronic
995917345 5:117264204-117264226 CATGTAGCAAAGATAGGATTGGG - Intergenic
996486817 5:124044874-124044896 CATGCAGCATACATGGAAGTGGG + Intergenic
996902503 5:128558658-128558680 CCTGTAGCATAGTTTGAATTTGG - Intronic
997853014 5:137349474-137349496 CTTACAGCATAGATGGTATAGGG + Intronic
998351156 5:141502266-141502288 CAAGGAGCATAGATTGCATTTGG + Intronic
1000925107 5:167184703-167184725 CAGGCAGCACAGATGGGATGAGG - Intergenic
1002341616 5:178519979-178520001 GATGAAGCATAGATGGAAGATGG + Intronic
1002393065 5:178930879-178930901 CATGCAGAAGAGCTGGGATTGGG - Intronic
1003074816 6:2973726-2973748 CATCTAGCATAAATGGAAGTAGG + Intergenic
1006968398 6:38013875-38013897 CATGCAGTATAGATTAAATAGGG - Intronic
1008224555 6:48898179-48898201 AATGCAGCTGAGATGGAATACGG - Intergenic
1008349222 6:50469912-50469934 CAAGTAGAATAGAGGGAATTTGG - Intergenic
1009162317 6:60298538-60298560 CATACAGCCTAGAAGGGATTGGG - Intergenic
1009725170 6:67529369-67529391 GATGTAGACTAGATGGAATTTGG - Intergenic
1009987516 6:70799405-70799427 TATGCAGGATAGATGTGATTAGG + Intronic
1015375675 6:132507603-132507625 GATACAGCACAGATGGACTTTGG - Intronic
1016108824 6:140195674-140195696 CCTGCAGCATAGTTTGAAGTTGG - Intergenic
1016375657 6:143418072-143418094 CAGGCAGAAGAGATGGTATTTGG + Intergenic
1022545844 7:31188165-31188187 CATGCAGTGGAGATAGAATTAGG + Intergenic
1023394442 7:39739429-39739451 CCTGCAGGATAGAAGGAAATGGG + Intergenic
1023735630 7:43233826-43233848 AATGCAGCAAAGCTGGAAGTAGG + Intronic
1023767936 7:43529308-43529330 CATGGAGCAGGGAGGGAATTGGG - Intronic
1026077922 7:67190369-67190391 CATTTAGCATAGATTGATTTGGG + Intronic
1026698932 7:72621700-72621722 CATTTAGCATAGATTGATTTGGG - Intronic
1030702026 7:112650888-112650910 TATGCAGCATAGTTGGATCTTGG - Intergenic
1032629022 7:133626478-133626500 AATGCAGTATAGATGGCACTTGG + Intronic
1034042482 7:147894060-147894082 GATGGAGCAGAGAAGGAATTTGG - Intronic
1034137280 7:148782757-148782779 AATGCAGAATAGGTAGAATTGGG + Intronic
1035186422 7:157129461-157129483 CTTGCAGCATAAATTGAAATAGG + Intergenic
1038155587 8:24986440-24986462 CATGCAGCAGAGGGAGAATTGGG - Intergenic
1041836288 8:62219645-62219667 TATGCAGCATAGATGGCTCTGGG - Intergenic
1044485778 8:92752585-92752607 CATGCAGCACAGTTGCATTTGGG - Intergenic
1045765276 8:105660308-105660330 AATGCAGCTGAGATGGAGTTTGG - Intronic
1046554974 8:115763199-115763221 CATGCAGGATAGGTAGCATTTGG + Intronic
1046571917 8:115977117-115977139 CATGCAGTCTAAATGGAAATAGG + Intergenic
1046905179 8:119565014-119565036 CATGCATCCTAGAGAGAATTTGG - Intronic
1047540357 8:125759305-125759327 GCTGCACCATAGATGGAAGTGGG - Intergenic
1047887081 8:129263480-129263502 CATGTAGTATATATGGAAATAGG + Intergenic
1048608881 8:136000459-136000481 CTTGCAGCTTAGAGGAAATTTGG + Intergenic
1054970852 9:71084865-71084887 CTTGCAGCATAGTTTGAAGTTGG - Intronic
1056039911 9:82654129-82654151 ATTGTTGCATAGATGGAATTAGG - Intergenic
1056154358 9:83819173-83819195 CATGCAGTATCTATAGAATTTGG + Intronic
1057427954 9:94969155-94969177 AAAACAGCATAGATGGAATTAGG + Intronic
1057997779 9:99835337-99835359 TATGCAGCAGAGACAGAATTAGG + Intronic
1187199935 X:17125277-17125299 CATTCATCATAGAGGGAATGGGG - Intronic
1188995145 X:36875429-36875451 GCAGCAACATAGATGGAATTGGG + Intergenic
1193350532 X:80458593-80458615 AATGCAGCATATGTGAAATTTGG - Intergenic
1193502027 X:82288701-82288723 CATGTAGCATAGTTTGAAGTTGG + Intergenic
1195311407 X:103634873-103634895 GAAGCAGCATAGATGGGATCAGG + Intergenic
1196291899 X:113951760-113951782 CATGCAGGAAAGAAGGAATTAGG + Intergenic
1197547384 X:127841933-127841955 GCTGAAGCTTAGATGGAATTTGG - Intergenic
1198010847 X:132552190-132552212 AATATAGCCTAGATGGAATTCGG - Intergenic
1200171283 X:154077133-154077155 CATGCAGCAGGAATGGAACTTGG + Intronic
1201386125 Y:13441379-13441401 CATGGAGGATAGATGGCATTGGG + Intronic