ID: 976422504

View in Genome Browser
Species Human (GRCh38)
Location 4:84862482-84862504
Sequence ACCAGCACATAGTAGGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976422504_976422506 -9 Left 976422504 4:84862482-84862504 CCAATAACCTACTATGTGCTGGT 0: 1
1: 0
2: 2
3: 12
4: 119
Right 976422506 4:84862496-84862518 TGTGCTGGTATTTACAGTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976422504 Original CRISPR ACCAGCACATAGTAGGTTAT TGG (reversed) Intronic
902404363 1:16174820-16174842 CCCAGCACATAGTAGGTTCTCGG + Intergenic
902558638 1:17261891-17261913 AAAATCACAGAGTAGGTTATTGG + Intronic
902784601 1:18724987-18725009 GCCTGCACAAAGTAGGTGATGGG + Intronic
907515904 1:54993325-54993347 CCCAGCACATAGTAGGCTCTGGG - Intergenic
907992369 1:59595238-59595260 AACAGCACATAGTAGCTGCTTGG + Intronic
915025349 1:152824592-152824614 ATCAGCACCTAGTATGTTAATGG - Intergenic
916831664 1:168498592-168498614 ACATGCACATTGTAAGTTATTGG - Intergenic
917685659 1:177413151-177413173 TCCAGCACACAGTAGGTTGATGG + Intergenic
919197303 1:194302726-194302748 ACCAGCACATAAAATGTTAATGG + Intergenic
919559661 1:199101196-199101218 ACCAGAACATAGGAGCTTAGAGG + Intergenic
923128909 1:231057698-231057720 AACAGCACATAGCAGGTATTGGG + Intergenic
923658017 1:235935210-235935232 ACCAGCCCATGATAGGTTCTTGG + Intergenic
924186784 1:241500667-241500689 ACCAGAAAATAATATGTTATTGG - Intronic
1063516851 10:6705024-6705046 AGCAGCACATAGGAGGTAATAGG + Intergenic
1066075524 10:31871821-31871843 ACCAGCACATAGAGAGTCATGGG + Intronic
1068006687 10:51399461-51399483 ACAAGCACATGGAAGATTATAGG + Intronic
1068318502 10:55379487-55379509 TTTAGTACATAGTAGGTTATAGG + Intronic
1069816163 10:71195914-71195936 ACCTGCACACAGTAGGTGCTTGG - Intergenic
1074371376 10:112903332-112903354 ACCAGCTCATACTAGCTTCTAGG + Intergenic
1075063119 10:119270615-119270637 ACCTGCACAGAGCAGCTTATGGG - Intronic
1075489462 10:122854024-122854046 GCCAGCACCTAATAGGTTCTAGG - Intronic
1076865228 10:133163311-133163333 ACCGGCACACAGGAGGTTCTGGG - Intronic
1078758695 11:14234585-14234607 GCCAGCACACAGAAGGTCATAGG + Intronic
1079519741 11:21312596-21312618 ACTAGCACACAGAAGGTTAGAGG + Intronic
1079678079 11:23257976-23257998 AGAAGCACATAGTAGGATAGTGG + Intergenic
1084137587 11:67197891-67197913 TCCAGTAAACAGTAGGTTATTGG - Intronic
1084923112 11:72487917-72487939 ACCAGCACATTGGGGGTTAGGGG + Intergenic
1084993448 11:72951674-72951696 ACCAGGCCAAAGTAAGTTATAGG - Intronic
1089206075 11:116763894-116763916 ACTGGCACACAGTAGGTGATTGG - Intronic
1090651113 11:128807015-128807037 GCCAGCACATAGTAGATTCTAGG + Intronic
1093424508 12:19012684-19012706 ACAAGCATATGGTAGGTGATGGG + Intergenic
1098180677 12:67843246-67843268 ACGAGCACATTGTAGGTACTTGG + Intergenic
1098632976 12:72747165-72747187 ACAAACACATGGTATGTTATTGG - Intergenic
1100366771 12:93928781-93928803 ATCAGCACATATTATGTTCTAGG + Intergenic
1101969014 12:109299778-109299800 ATAAGCACATAGTAGGTACTTGG - Intronic
1102024856 12:109708582-109708604 ACTGGCACATAGTAGGATCTAGG - Intergenic
1102243908 12:111342981-111343003 TCCAGCACATAGTATGTGGTGGG + Intronic
1102544541 12:113645243-113645265 TCCAGCACATGGTAAGTTCTTGG - Intergenic
1103755323 12:123201004-123201026 AACAGTAGATAGCAGGTTATGGG - Intronic
1104638249 12:130451028-130451050 TCCAGCACATAGTAGGGCAAGGG + Intronic
1105273458 13:18900007-18900029 ACCAGCAGATCGTTGGTTGTTGG - Intergenic
1106646771 13:31643264-31643286 AACAGCACAAAGTAGGTCAGTGG + Intergenic
1107029883 13:35839707-35839729 ATAAGCACTGAGTAGGTTATTGG + Intronic
1111839627 13:93433802-93433824 ACCAATACATAGCAGATTATAGG + Intronic
1112595988 13:100807218-100807240 ACCAGCACTTAGTAGGTACCAGG - Intergenic
1112802412 13:103126953-103126975 ACCAACCCCTTGTAGGTTATTGG - Intergenic
1114204822 14:20559334-20559356 ACAAACACAAAGTAGATTATAGG + Intronic
1116466874 14:45244112-45244134 ACCACTACACAGTAGGTTGTGGG - Intronic
1116662217 14:47725191-47725213 ACAAGCACTTATTAGTTTATAGG + Intergenic
1121116773 14:91349174-91349196 CCCAGCACATAGTAGGTACTTGG - Intronic
1121724786 14:96139355-96139377 ACCAGCACATAATGGGCAATAGG - Intergenic
1122069588 14:99196965-99196987 ACCAGAACATGGAAGGTTCTTGG - Intronic
1124451787 15:29799745-29799767 ATCTGCACATAGTAGATAATGGG - Intronic
1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG + Intronic
1129497392 15:75998163-75998185 ACAAGCATAGAGTAGGTTTTCGG - Intronic
1134685795 16:16157387-16157409 CCCAGCACATATTAGGTGCTGGG + Intronic
1135146856 16:19970148-19970170 CGCAGCACATAGTAGGTGCTGGG + Intergenic
1138616340 16:58170280-58170302 ACCAGCAAATAGCAGGTCAGTGG - Intronic
1139440604 16:66964766-66964788 GCCAGCACAGAGTGGGGTATGGG - Intronic
1141431748 16:83973723-83973745 CCCAGCACACAGTAGGTCCTCGG + Intronic
1143055842 17:4161206-4161228 CCTGGCACATAGTAGGTTCTTGG - Intronic
1144013435 17:11171696-11171718 CCCACCACACAGTAGGGTATGGG - Intergenic
1144068596 17:11646416-11646438 TCCAGCACATGGTAGGTGCTTGG + Intronic
1144321835 17:14130939-14130961 ACCATCACAAAGTAGGTCTTTGG + Intronic
1152963309 18:93950-93972 AACAGCACATACTTAGTTATGGG + Intergenic
1152975347 18:211646-211668 AACAGCAAATAATAGGTAATAGG - Exonic
1154055570 18:11010171-11010193 ACCAGTACCTAGTAGGTGTTTGG - Intronic
1154465215 18:14637572-14637594 ACCAGCACATTGTTGGTTGTTGG - Intergenic
1155340055 18:24804736-24804758 TCTAGCACACAGTAGGTTCTTGG + Intergenic
1158952774 18:62510791-62510813 ACCAGGACAGAGCAGGTCATGGG + Intergenic
1163785125 19:19271020-19271042 ACCAGCATAGAGTGGGTCATAGG + Exonic
1166552022 19:43672127-43672149 CCCAGCACAAAGTAGGTCCTTGG - Intergenic
933856628 2:86420380-86420402 CCAAGCACATAGTAGGTGTTCGG + Intergenic
935707706 2:105870918-105870940 CCCAGCACATCGTAGGATCTTGG + Intronic
936527645 2:113252511-113252533 GCCAGCACACATGAGGTTATGGG + Intronic
937494875 2:122407920-122407942 TCTAGCACATAGTAGGTGTTCGG - Intergenic
939643507 2:144669006-144669028 ACCAGCAGATATTTTGTTATAGG + Intergenic
946576706 2:221083408-221083430 AGGAGCACAGAGTGGGTTATTGG + Intergenic
1173093972 20:40006394-40006416 AACAGCACATAGTACCTGATTGG + Intergenic
1176809325 21:13520814-13520836 ACCAGCACATCGTTGGTTGTTGG + Intergenic
1183930646 22:41234236-41234258 ACCAGCACAGTGTGGCTTATAGG + Intronic
953221486 3:40975722-40975744 GTCAGCACATGGTAGGTTCTTGG + Intergenic
953585581 3:44198301-44198323 ACCAGGACAAAGTAGATGATGGG + Intergenic
955908237 3:63830436-63830458 ACCTACACAAAGTAGGATATGGG - Intronic
956205795 3:66753477-66753499 ACCAGCACTTAGTAGGTAGAGGG - Intergenic
963252421 3:143115545-143115567 ACCAGCACCTGGTACATTATAGG + Intergenic
963260732 3:143188649-143188671 ACCAGCACACAGTGTTTTATAGG - Intergenic
967515230 3:190361167-190361189 ACTAGCACATAGTGGGTGCTGGG - Intronic
967821105 3:193839876-193839898 ACAAGCACAAAGTAGATTCTTGG - Intergenic
973554913 4:52073163-52073185 ACAGGCACAGAATAGGTTATTGG - Intronic
976422504 4:84862482-84862504 ACCAGCACATAGTAGGTTATTGG - Intronic
977313445 4:95414761-95414783 ACCTCAAAATAGTAGGTTATGGG - Intronic
983237040 4:165191343-165191365 AGCAGCACAGAGTAGGTGCTTGG + Intronic
990361234 5:55022100-55022122 GCCAGCACATAGGAGCTTAAGGG + Intronic
994568936 5:101488301-101488323 AGCAGCACATAGTAGTTAAGTGG - Intergenic
995713379 5:115057154-115057176 CCTAGCACATAGTAGGTATTTGG - Intergenic
996353222 5:122568838-122568860 TCTAGCACATAGGAGGTTTTCGG - Intergenic
998160900 5:139812491-139812513 CCCCGCACATAGTAGGTGCTTGG - Intronic
998729242 5:145054922-145054944 ACCAGCACATAGTAGGTGCTCGG - Intergenic
1001174932 5:169459358-169459380 CCCAGCACATAGTAGGCTCTTGG + Intergenic
1001522389 5:172403855-172403877 CCTGGCACATAGTAGATTATTGG - Intronic
1006368969 6:33632889-33632911 CCCAGCACATAGTAGGCTCGTGG + Intronic
1006646596 6:35519209-35519231 CCAAGCACATAGTAGGTGCTTGG - Intergenic
1007016863 6:38477329-38477351 GCTAGCACATAGTAGGTACTAGG - Intronic
1014812360 6:125901583-125901605 ACCAGCCCATAGTAGCGTCTAGG + Intronic
1017642767 6:156510277-156510299 TCAAGCACATAGTAGGTTCCTGG - Intergenic
1018098134 6:160411338-160411360 ACCAGCATATAGGAGTTTAGAGG - Intronic
1024875458 7:54017566-54017588 ACAAACACATTGTAGGTTATAGG + Intergenic
1026798108 7:73378595-73378617 ATCAGCACAGAGTAGGCTATAGG - Intergenic
1031145224 7:117990173-117990195 TCCAGCCAACAGTAGGTTATTGG + Intergenic
1032011061 7:128348319-128348341 CCCAGCACCTAGTACGTCATAGG + Intergenic
1036404281 8:8441163-8441185 ACCTTCACATAGAAGTTTATGGG + Intergenic
1039219611 8:35315039-35315061 GTCAGCACATACTAGGTTCTAGG + Intronic
1042146008 8:65731031-65731053 ACCAGCACATGGTAGGTACTTGG - Intronic
1044549130 8:93492945-93492967 TCCAACACTTAGTATGTTATAGG - Intergenic
1050754880 9:8990427-8990449 GGTAGCACATAGTAGGTTGTTGG + Intronic
1050946540 9:11527866-11527888 CCCAGCACATAGTAGGCAGTCGG + Intergenic
1055566062 9:77569451-77569473 CCCAACACATAGTAGGTCCTCGG - Intronic
1055887041 9:81075685-81075707 ACCAGCACATATCAGGGTAATGG - Intergenic
1059101489 9:111476538-111476560 AACAGAACATAGTAGATTTTTGG - Intronic
1060157601 9:121330803-121330825 ACCGGCACATAGTAGACTCTCGG + Intronic
1062734782 9:138129753-138129775 AACAGCACATACTTAGTTATGGG - Intergenic
1186848864 X:13559488-13559510 ACCAGCACATGGTAGGCACTAGG + Intergenic
1187999305 X:24964773-24964795 TCCGGCACATAGTAGGTACTTGG - Intronic
1188266155 X:28077846-28077868 ACTATCACATAGCAGGTTATTGG + Intergenic
1188815853 X:34713325-34713347 ACCAGCACACAGTATGTTCTTGG - Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1190332169 X:49242715-49242737 ACCTGTACATAGTAGGTGCTCGG + Intronic
1192186076 X:68947732-68947754 CCCAGCACAGAGTAGGTATTTGG + Intergenic
1198145890 X:133857544-133857566 ACCAACACATAGTATGATTTGGG + Intronic
1199033019 X:143022897-143022919 CCTAGCATATAGTAGGTTCTTGG + Intergenic
1200139067 X:153888700-153888722 AACAGCACATAGTTGGGTTTTGG + Intronic
1201011613 Y:9552388-9552410 ACCAGCACACAGTAAGATAATGG - Intergenic
1201063011 Y:10065154-10065176 ACCAGCACACAGTAAGATAGAGG + Intergenic