ID: 976441901

View in Genome Browser
Species Human (GRCh38)
Location 4:85085543-85085565
Sequence GAAACCAGACAGACAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441901_976441910 28 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441910 4:85085594-85085616 AACCAGAAGCCGGAGGGCAAGGG No data
976441901_976441909 27 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441909 4:85085593-85085615 TAACCAGAAGCCGGAGGGCAAGG No data
976441901_976441907 21 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441907 4:85085587-85085609 AGATCTTAACCAGAAGCCGGAGG No data
976441901_976441904 -3 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441904 4:85085563-85085585 TTCCTGAGTTGCTCTTTATTGGG No data
976441901_976441903 -4 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441903 4:85085562-85085584 TTTCCTGAGTTGCTCTTTATTGG No data
976441901_976441908 22 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441908 4:85085588-85085610 GATCTTAACCAGAAGCCGGAGGG No data
976441901_976441906 18 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441906 4:85085584-85085606 GGAAGATCTTAACCAGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441901 Original CRISPR GAAACCAGACAGACAGTGGA AGG (reversed) Intergenic