ID: 976441903

View in Genome Browser
Species Human (GRCh38)
Location 4:85085562-85085584
Sequence TTTCCTGAGTTGCTCTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441901_976441903 -4 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441903 4:85085562-85085584 TTTCCTGAGTTGCTCTTTATTGG No data
976441902_976441903 -8 Left 976441902 4:85085547-85085569 CCACTGTCTGTCTGGTTTCCTGA No data
Right 976441903 4:85085562-85085584 TTTCCTGAGTTGCTCTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441903 Original CRISPR TTTCCTGAGTTGCTCTTTAT TGG Intergenic