ID: 976441904

View in Genome Browser
Species Human (GRCh38)
Location 4:85085563-85085585
Sequence TTCCTGAGTTGCTCTTTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441902_976441904 -7 Left 976441902 4:85085547-85085569 CCACTGTCTGTCTGGTTTCCTGA 0: 1
1: 0
2: 4
3: 38
4: 391
Right 976441904 4:85085563-85085585 TTCCTGAGTTGCTCTTTATTGGG No data
976441901_976441904 -3 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441904 4:85085563-85085585 TTCCTGAGTTGCTCTTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441904 Original CRISPR TTCCTGAGTTGCTCTTTATT GGG Intergenic