ID: 976441905

View in Genome Browser
Species Human (GRCh38)
Location 4:85085565-85085587
Sequence TTCCCAATAAAGAGCAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441905_976441907 -1 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441907 4:85085587-85085609 AGATCTTAACCAGAAGCCGGAGG No data
976441905_976441906 -4 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441906 4:85085584-85085606 GGAAGATCTTAACCAGAAGCCGG No data
976441905_976441913 21 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441913 4:85085609-85085631 GGCAAGGGAGCCTTGAGATGTGG No data
976441905_976441910 6 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441910 4:85085594-85085616 AACCAGAAGCCGGAGGGCAAGGG No data
976441905_976441909 5 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441909 4:85085593-85085615 TAACCAGAAGCCGGAGGGCAAGG No data
976441905_976441908 0 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441908 4:85085588-85085610 GATCTTAACCAGAAGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441905 Original CRISPR TTCCCAATAAAGAGCAACTC AGG (reversed) Intergenic