ID: 976441907

View in Genome Browser
Species Human (GRCh38)
Location 4:85085587-85085609
Sequence AGATCTTAACCAGAAGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441901_976441907 21 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441907 4:85085587-85085609 AGATCTTAACCAGAAGCCGGAGG No data
976441902_976441907 17 Left 976441902 4:85085547-85085569 CCACTGTCTGTCTGGTTTCCTGA No data
Right 976441907 4:85085587-85085609 AGATCTTAACCAGAAGCCGGAGG No data
976441905_976441907 -1 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441907 4:85085587-85085609 AGATCTTAACCAGAAGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441907 Original CRISPR AGATCTTAACCAGAAGCCGG AGG Intergenic