ID: 976441908

View in Genome Browser
Species Human (GRCh38)
Location 4:85085588-85085610
Sequence GATCTTAACCAGAAGCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441905_976441908 0 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441908 4:85085588-85085610 GATCTTAACCAGAAGCCGGAGGG No data
976441902_976441908 18 Left 976441902 4:85085547-85085569 CCACTGTCTGTCTGGTTTCCTGA No data
Right 976441908 4:85085588-85085610 GATCTTAACCAGAAGCCGGAGGG No data
976441901_976441908 22 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441908 4:85085588-85085610 GATCTTAACCAGAAGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441908 Original CRISPR GATCTTAACCAGAAGCCGGA GGG Intergenic