ID: 976441909

View in Genome Browser
Species Human (GRCh38)
Location 4:85085593-85085615
Sequence TAACCAGAAGCCGGAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441902_976441909 23 Left 976441902 4:85085547-85085569 CCACTGTCTGTCTGGTTTCCTGA No data
Right 976441909 4:85085593-85085615 TAACCAGAAGCCGGAGGGCAAGG No data
976441905_976441909 5 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441909 4:85085593-85085615 TAACCAGAAGCCGGAGGGCAAGG No data
976441901_976441909 27 Left 976441901 4:85085543-85085565 CCTTCCACTGTCTGTCTGGTTTC No data
Right 976441909 4:85085593-85085615 TAACCAGAAGCCGGAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441909 Original CRISPR TAACCAGAAGCCGGAGGGCA AGG Intergenic