ID: 976441911

View in Genome Browser
Species Human (GRCh38)
Location 4:85085596-85085618
Sequence CTCCCTTGCCCTCCGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441911_976441913 -10 Left 976441911 4:85085596-85085618 CCAGAAGCCGGAGGGCAAGGGAG No data
Right 976441913 4:85085609-85085631 GGCAAGGGAGCCTTGAGATGTGG No data
976441911_976441917 24 Left 976441911 4:85085596-85085618 CCAGAAGCCGGAGGGCAAGGGAG No data
Right 976441917 4:85085643-85085665 CAACTCTTTGGGTCCAGAACAGG No data
976441911_976441915 12 Left 976441911 4:85085596-85085618 CCAGAAGCCGGAGGGCAAGGGAG No data
Right 976441915 4:85085631-85085653 GTACACAGAGATCAACTCTTTGG No data
976441911_976441916 13 Left 976441911 4:85085596-85085618 CCAGAAGCCGGAGGGCAAGGGAG No data
Right 976441916 4:85085632-85085654 TACACAGAGATCAACTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441911 Original CRISPR CTCCCTTGCCCTCCGGCTTC TGG (reversed) Intergenic
No off target data available for this crispr