ID: 976441913

View in Genome Browser
Species Human (GRCh38)
Location 4:85085609-85085631
Sequence GGCAAGGGAGCCTTGAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441911_976441913 -10 Left 976441911 4:85085596-85085618 CCAGAAGCCGGAGGGCAAGGGAG No data
Right 976441913 4:85085609-85085631 GGCAAGGGAGCCTTGAGATGTGG No data
976441905_976441913 21 Left 976441905 4:85085565-85085587 CCTGAGTTGCTCTTTATTGGGAA No data
Right 976441913 4:85085609-85085631 GGCAAGGGAGCCTTGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441913 Original CRISPR GGCAAGGGAGCCTTGAGATG TGG Intergenic
No off target data available for this crispr