ID: 976441915

View in Genome Browser
Species Human (GRCh38)
Location 4:85085631-85085653
Sequence GTACACAGAGATCAACTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441911_976441915 12 Left 976441911 4:85085596-85085618 CCAGAAGCCGGAGGGCAAGGGAG No data
Right 976441915 4:85085631-85085653 GTACACAGAGATCAACTCTTTGG No data
976441912_976441915 5 Left 976441912 4:85085603-85085625 CCGGAGGGCAAGGGAGCCTTGAG No data
Right 976441915 4:85085631-85085653 GTACACAGAGATCAACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441915 Original CRISPR GTACACAGAGATCAACTCTT TGG Intergenic
No off target data available for this crispr