ID: 976441917

View in Genome Browser
Species Human (GRCh38)
Location 4:85085643-85085665
Sequence CAACTCTTTGGGTCCAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976441911_976441917 24 Left 976441911 4:85085596-85085618 CCAGAAGCCGGAGGGCAAGGGAG No data
Right 976441917 4:85085643-85085665 CAACTCTTTGGGTCCAGAACAGG No data
976441912_976441917 17 Left 976441912 4:85085603-85085625 CCGGAGGGCAAGGGAGCCTTGAG No data
Right 976441917 4:85085643-85085665 CAACTCTTTGGGTCCAGAACAGG No data
976441914_976441917 1 Left 976441914 4:85085619-85085641 CCTTGAGATGTGGTACACAGAGA No data
Right 976441917 4:85085643-85085665 CAACTCTTTGGGTCCAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976441917 Original CRISPR CAACTCTTTGGGTCCAGAAC AGG Intergenic
No off target data available for this crispr