ID: 976442561

View in Genome Browser
Species Human (GRCh38)
Location 4:85092263-85092285
Sequence CATGTTGCCCACGTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976442555_976442561 26 Left 976442555 4:85092214-85092236 CCACCATACCAAGCTAATTTCTA No data
Right 976442561 4:85092263-85092285 CATGTTGCCCACGTTGATCTTGG No data
976442556_976442561 23 Left 976442556 4:85092217-85092239 CCATACCAAGCTAATTTCTACAT No data
Right 976442561 4:85092263-85092285 CATGTTGCCCACGTTGATCTTGG No data
976442557_976442561 18 Left 976442557 4:85092222-85092244 CCAAGCTAATTTCTACATTTTTT No data
Right 976442561 4:85092263-85092285 CATGTTGCCCACGTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976442561 Original CRISPR CATGTTGCCCACGTTGATCT TGG Intergenic
No off target data available for this crispr