ID: 976445430

View in Genome Browser
Species Human (GRCh38)
Location 4:85125696-85125718
Sequence GCACAGATGTATGCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976445421_976445430 29 Left 976445421 4:85125644-85125666 CCCTACATCTCCCCCTTTTCTGT No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data
976445425_976445430 17 Left 976445425 4:85125656-85125678 CCCTTTTCTGTTTTCTGCATCAG No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data
976445426_976445430 16 Left 976445426 4:85125657-85125679 CCTTTTCTGTTTTCTGCATCAGG No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data
976445424_976445430 18 Left 976445424 4:85125655-85125677 CCCCTTTTCTGTTTTCTGCATCA No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data
976445422_976445430 28 Left 976445422 4:85125645-85125667 CCTACATCTCCCCCTTTTCTGTT No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data
976445429_976445430 -7 Left 976445429 4:85125680-85125702 CCTTATTGATTGGAGAGCACAGA No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data
976445420_976445430 30 Left 976445420 4:85125643-85125665 CCCCTACATCTCCCCCTTTTCTG No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data
976445423_976445430 19 Left 976445423 4:85125654-85125676 CCCCCTTTTCTGTTTTCTGCATC No data
Right 976445430 4:85125696-85125718 GCACAGATGTATGCAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976445430 Original CRISPR GCACAGATGTATGCAGCAAC AGG Intergenic
No off target data available for this crispr