ID: 976455831

View in Genome Browser
Species Human (GRCh38)
Location 4:85246185-85246207
Sequence TCCCTAGGGCGTGGGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976455819_976455831 23 Left 976455819 4:85246139-85246161 CCCTCGCTCGGCCTGGCCATGGC 0: 1
1: 0
2: 1
3: 14
4: 155
Right 976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 182
976455820_976455831 22 Left 976455820 4:85246140-85246162 CCTCGCTCGGCCTGGCCATGGCG 0: 1
1: 0
2: 2
3: 13
4: 145
Right 976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 182
976455823_976455831 12 Left 976455823 4:85246150-85246172 CCTGGCCATGGCGGCGGTGCTCT 0: 1
1: 0
2: 2
3: 8
4: 92
Right 976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 182
976455817_976455831 24 Left 976455817 4:85246138-85246160 CCCCTCGCTCGGCCTGGCCATGG 0: 1
1: 0
2: 2
3: 7
4: 168
Right 976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 182
976455824_976455831 7 Left 976455824 4:85246155-85246177 CCATGGCGGCGGTGCTCTACAGA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG 0: 1
1: 0
2: 2
3: 29
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976455831 Original CRISPR TCCCTAGGGCGTGGGTGTGC AGG Intergenic
900577240 1:3389416-3389438 TCCCTATGGCGTGGGGCTGAGGG + Intronic
900975870 1:6015987-6016009 TCTCTAGGGGCTGGGTGTGATGG - Intronic
901192837 1:7422723-7422745 TGCCTATGGAGTGGGTGTGAGGG - Intronic
904811026 1:33163623-33163645 ACCCTAGGGCCTGGAGGTGCTGG + Intronic
907098110 1:51800482-51800504 TCCCTAGTGGGTGGGTGTGGGGG - Intronic
907437147 1:54457250-54457272 TCCCTAGGGGCTGGGAGTGTTGG + Intergenic
917495427 1:175536375-175536397 TGGCTAGGGCCTGGGTGTCCTGG + Intronic
917749036 1:178037896-178037918 TCCCTCGGGCGTGGGTCTGCAGG - Intergenic
920189383 1:204182979-204183001 GCCTTCGGGCCTGGGTGTGCAGG + Intergenic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1064552989 10:16521220-16521242 TCCCCTGGGCGTGCGTGCGCCGG + Exonic
1066185965 10:33010713-33010735 GCCCTGAGGCTTGGGTGTGCTGG + Intergenic
1069932003 10:71889205-71889227 TCCCTTGGGGGTGGGGGTGGGGG + Intergenic
1071515200 10:86292399-86292421 TCCCTAGGGCATGTGGCTGCAGG - Intronic
1073782249 10:106850851-106850873 GCCGTAGGGCGTGTGTGTGGTGG - Intronic
1074338303 10:112600462-112600484 ACCCTGGGGCAAGGGTGTGCTGG - Intronic
1076723175 10:132401573-132401595 TCCCTAGGGGGTGGGTGTGTGGG + Intronic
1076936357 10:133569056-133569078 TCCCTGGGGCACGGGTCTGCTGG - Intronic
1081869574 11:46377194-46377216 TCACCGGGGCGTGGGTGAGCAGG - Exonic
1081908566 11:46685189-46685211 TCTCTAGGTGGTGGGTGTGTGGG + Intronic
1084792669 11:71484469-71484491 TCCCCTGGGGGTGGGGGTGCAGG + Intronic
1085269282 11:75260724-75260746 TCCCTGGGGGGTGGGAGTGGGGG + Intergenic
1088595755 11:111439046-111439068 TGCCCAGCGGGTGGGTGTGCGGG - Intronic
1090161697 11:124502034-124502056 TTCCTAGGAAGTGGGAGTGCGGG - Intergenic
1090805451 11:130199392-130199414 TGCCTTGGGCTTGGGTGAGCTGG - Intronic
1091802555 12:3333848-3333870 TCCCTAGGGACTGGGCCTGCAGG + Intergenic
1094447511 12:30547103-30547125 TCCCTAGTGCGCGTGTGTGGAGG + Intergenic
1094496911 12:30994399-30994421 TTCCTAGGGCCCTGGTGTGCAGG - Exonic
1095759006 12:45806343-45806365 TCCCTGGGGCTAGGGTGTCCGGG - Intronic
1097647051 12:62249029-62249051 ACCCTGGGGCATGGGTGTGGGGG - Intronic
1104636962 12:130443665-130443687 CACCTAGGGTGTGGGTCTGCAGG + Intronic
1107792882 13:44019840-44019862 GCCCTAGGGTGAGGGTGTGGAGG + Intergenic
1113416054 13:110129594-110129616 AGCTTAGGGGGTGGGTGTGCAGG + Intergenic
1113668117 13:112154798-112154820 GCCATGGGGGGTGGGTGTGCAGG + Intergenic
1113804990 13:113107301-113107323 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805004 13:113107335-113107357 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805030 13:113107403-113107425 TCCCGGGGGAGTGGGTGTCCCGG + Intronic
1113805056 13:113107471-113107493 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805070 13:113107505-113107527 TCCCGGGGGAGTGGGTGTCCCGG + Intronic
1113805096 13:113107573-113107595 TCCCGGGGGAGTGGGTGTCCCGG + Intronic
1113805122 13:113107641-113107663 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805128 13:113107658-113107680 TCCCGGGAGCGTGGGTGTCCCGG + Intronic
1113805136 13:113107675-113107697 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805150 13:113107709-113107731 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805164 13:113107743-113107765 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805193 13:113107828-113107850 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805201 13:113107845-113107867 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805209 13:113107862-113107884 TCCCGGGGGCGTGGGTGTTCCGG + Intronic
1113805223 13:113107913-113107935 TCCCAGGGGCGTGGGTGTCCCGG + Intronic
1113805231 13:113107930-113107952 TCCCGGGGGTGTGGGTGTCCCGG + Intronic
1113805239 13:113107947-113107969 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805275 13:113108049-113108071 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805310 13:113108151-113108173 TCCCAGGGGCGTGGGTGTCCCGG + Intronic
1113805346 13:113108253-113108275 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805390 13:113108373-113108395 TCCCGGGGGTGTGGGTGTCCCGG + Intronic
1113805398 13:113108390-113108412 TCCCGGGGGTGTGGGTGTCCCGG + Intronic
1113805412 13:113108424-113108446 TCCCGGGGGAGTGGGTGTCCCGG + Intronic
1113805428 13:113108475-113108497 TCCCAGGAGCGTGGGTGTCCCGG + Intronic
1113805440 13:113108509-113108531 TCCCGGGAGCGTGGGTGTCCCGG + Intronic
1113805448 13:113108526-113108548 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805462 13:113108560-113108582 TCCCGGGGGAGTGGGTGTCCCGG + Intronic
1113805487 13:113108628-113108650 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805507 13:113108696-113108718 TCCCGGGGGTGTGGGTGTCCCGG + Intronic
1113805538 13:113108782-113108804 TCCCAGGGGTGTGGGTGTCCCGG + Intronic
1113805546 13:113108799-113108821 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805560 13:113108833-113108855 TCCCGGGGGAGTGGGTGTCCCGG + Intronic
1113805588 13:113108918-113108940 TCCCGGGAGCGTGGGTGTCCCGG + Intronic
1113805596 13:113108935-113108957 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805609 13:113108969-113108991 TCCCAGGGGTGTGGGTGTCCCGG + Intronic
1113805617 13:113108986-113109008 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805666 13:113109122-113109144 TCCCGGGGGCGTGGGTGTCCCGG + Intronic
1113805690 13:113109190-113109212 TCCCAGGGGCGTGGGTGTCCGGG + Intronic
1113805698 13:113109207-113109229 TCCGGGGGGCGTGGGTGTCCCGG + Intronic
1113805705 13:113109224-113109246 TCCCGGGGGTGTGGGTGTCCCGG + Intronic
1113951313 13:114072715-114072737 TCCCTGGGGCTCTGGTGTGCAGG - Intronic
1115855088 14:37622361-37622383 TCCCTCGGGCCTGGGTGAGGCGG + Intronic
1119199996 14:72745081-72745103 TCCTCAGGGGGTGGGTGTGGAGG + Intronic
1119872609 14:78030046-78030068 TCCCCAGGGCTGGGGTGTCCTGG + Intergenic
1120632614 14:86909503-86909525 TCCATAGGGAGTGTGTGTTCAGG - Intronic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1121248942 14:92485174-92485196 TCCCTAGAGACTGGGTGTGGTGG + Intronic
1123068691 14:105630586-105630608 TCCCTGGGGCCTGGGGATGCTGG + Intergenic
1123098278 14:105776614-105776636 TCCCTGGGGCCTGGGGATGCTGG + Intergenic
1129204395 15:74027291-74027313 TCCCAAGGTCCTGGGTTTGCAGG - Intronic
1130040742 15:80404049-80404071 CACCTGGGGCGTGGGCGTGCGGG + Intergenic
1130377803 15:83345558-83345580 TCCTTAGGCCGGGCGTGTGCCGG + Intergenic
1133046086 16:3089102-3089124 TCTCGCGGGCGTGGGTGCGCAGG + Exonic
1135743105 16:24993649-24993671 TCCCTGTTTCGTGGGTGTGCAGG + Intronic
1139361778 16:66403947-66403969 TCCAGAGGGGGTGGGTGTGGAGG - Exonic
1141887050 16:86899336-86899358 TGCAAGGGGCGTGGGTGTGCTGG - Intergenic
1142130964 16:88431294-88431316 TCCCGACGGCTTGGGGGTGCCGG - Exonic
1142242239 16:88952860-88952882 TCCCCAGGGTGTGGGGGTGGGGG - Intronic
1142592382 17:1012052-1012074 TCTCCAGGGTGTGTGTGTGCTGG - Intronic
1142685024 17:1572616-1572638 TGACTAGGGGGTGGGAGTGCAGG + Intronic
1142687816 17:1587842-1587864 TGACTAGGGGGTGGGGGTGCAGG + Intronic
1142866748 17:2796072-2796094 GCCCTCGGGAGTGGGTGTGAAGG + Intronic
1143852355 17:9822276-9822298 TCCCCAGGAGGTAGGTGTGCGGG + Intronic
1144786487 17:17835268-17835290 TCCCTAGGGCTTGGGATTTCAGG + Intronic
1145867512 17:28250480-28250502 GCCCTCGGGGGTGGGCGTGCGGG - Intergenic
1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG + Intronic
1147689294 17:42305727-42305749 GTCCTAGGGCCTGGGGGTGCTGG - Intronic
1148198687 17:45733403-45733425 TCCCAAGGGCGTGGGGGTCAGGG - Intergenic
1148261966 17:46192610-46192632 CCCCAAGGGCGGGGGTGTGCGGG - Exonic
1148318252 17:46723762-46723784 TGGCCAGGGAGTGGGTGTGCTGG - Intronic
1148793177 17:50184965-50184987 CCCCCAGGGCCTGGGGGTGCTGG + Exonic
1149868265 17:60162363-60162385 TCCCCAGGGTGGGGGTCTGCTGG - Intronic
1152371272 17:79890135-79890157 TCCCTAGGGAGTGCCTGTTCCGG + Intergenic
1152373948 17:79908314-79908336 ACCCACGGGCGTGGGTCTGCTGG + Intergenic
1152771710 17:82173847-82173869 TCCCTAGGAACTGGGTGGGCGGG - Intronic
1155386380 18:25282416-25282438 CCCCTAAGGCTTGGGTGTGAAGG - Intronic
1155703376 18:28777969-28777991 TCCCTAGGGAGTGTCTGTGGAGG + Intergenic
1156187630 18:34681732-34681754 TCCATAGGGTGTGTGTGTGTGGG - Intronic
1159259366 18:65991948-65991970 TCCCTTGAGCCTGGGTGGGCCGG - Intergenic
1160766456 19:810760-810782 CCCCGAGGTCGTGGTTGTGCAGG - Exonic
1161144685 19:2670669-2670691 TCTCTCGGGCGGGGCTGTGCTGG + Intronic
1161487587 19:4544074-4544096 GGCCCAGGGCGTGGGGGTGCGGG + Exonic
1161522583 19:4733086-4733108 TACCTAGGGCCTGGGTGCGGTGG + Intergenic
1161627271 19:5334609-5334631 GCCCTGGGGTGTGTGTGTGCGGG + Intronic
1161808023 19:6456329-6456351 TCCCCAGGGCTTGGATGGGCTGG - Intronic
1162914108 19:13865292-13865314 TCCCTAGGCCGTGGGCGGGGGGG - Intronic
1163168595 19:15515037-15515059 TGCCCAGGGCGTGGATCTGCTGG + Intronic
1166559084 19:43720052-43720074 TGCCTGGGGGGTGGGTGTGGAGG + Intergenic
1168296044 19:55377740-55377762 TCCCTGGGGCGTGGGTCTGGCGG + Intronic
925417396 2:3680263-3680285 TCCCTGGAACGTGGGTGAGCAGG + Intronic
925469033 2:4139068-4139090 TACCTAGGGGCTGGGTGTGGTGG + Intergenic
926238779 2:11069307-11069329 TCCCGAGGGTGTGTGTCTGCAGG + Intergenic
927110846 2:19862846-19862868 TCCCTGGGGCTTGGGAGTGCTGG - Intergenic
928977635 2:37105339-37105361 TCCCTGGGGGTGGGGTGTGCTGG + Exonic
933307660 2:80621876-80621898 TCCCTGTGGCCTGGGTGGGCTGG + Intronic
934558489 2:95300065-95300087 TCCCTAGGGCTTGGGGGTTGCGG + Intronic
935899221 2:107772918-107772940 TCCCTAGGCAGTGGGTGTCAAGG - Intergenic
936155003 2:110041586-110041608 TCCCATGGGCCTGGGAGTGCAGG + Intergenic
936189679 2:110329828-110329850 TCCCATGGGCCTGGGAGTGCAGG - Intergenic
938207577 2:129437383-129437405 TCCATGGGGAGTGCGTGTGCTGG - Intergenic
943480004 2:188405404-188405426 GGCCTAGAGCTTGGGTGTGCTGG - Intronic
945813660 2:214577460-214577482 TCCCTAAGGAGTGGGAGTGAGGG + Exonic
946368514 2:219266127-219266149 ACCCTAGGGCAGGGGAGTGCAGG + Intronic
948040917 2:234900841-234900863 TGCCCAGGGCGAGGGTGGGCAGG - Intergenic
948126327 2:235567194-235567216 TGCCTAGAGCTTGGATGTGCGGG + Intronic
948920721 2:241064736-241064758 TCCCTCCTGCGTGGGTGTGGAGG - Intronic
1168793416 20:595578-595600 GCCCTGGGGCGTGGGTGTTTTGG - Intergenic
1172300412 20:33845822-33845844 GCCCCAGGGCGTGGGGCTGCAGG - Intronic
1174240515 20:49130748-49130770 TCCCTGAGGGGTGGGTGTGGTGG + Intronic
1176255967 20:64153137-64153159 CCTCTCGGGCGTGGGTTTGCTGG - Intronic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1179603855 21:42499401-42499423 TTCCTGGGGCGTGGGAGTGGTGG + Intronic
1179679765 21:43010959-43010981 TCCGTAGGGCTGGGGTGTTCGGG + Intronic
1180997856 22:19974321-19974343 CTCCCAGGGCGTGGGTGAGCTGG + Intronic
1181002149 22:19992851-19992873 TCCCCAGAGCCAGGGTGTGCTGG - Intronic
1181669723 22:24420466-24420488 TCCCTTGGGCCTGGGGGTGGGGG + Intronic
1182586775 22:31347858-31347880 GCCCTAGAGCGGAGGTGTGCAGG - Intergenic
1184018679 22:41805306-41805328 TCCCAAGGGCCTGGGAGTACAGG - Intronic
1184438683 22:44495993-44496015 ACCCTCAGGCGTGGGTGTGTAGG + Exonic
949942421 3:9165105-9165127 GCCCCAGGGCCTGGGTCTGCTGG + Intronic
953929509 3:46998952-46998974 TCCCCAGGCGGTGGGTGCGCTGG + Exonic
954659479 3:52219322-52219344 TCCCCAGGGCATGGCTGTGGGGG - Intergenic
954813151 3:53260293-53260315 TCCCTGGGGAGTGGCTGTGGGGG - Intergenic
962410966 3:135141560-135141582 TTGCTAGGAGGTGGGTGTGCAGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
967224224 3:187275485-187275507 TCCCCAGGCGGTAGGTGTGCTGG + Intronic
968183119 3:196611917-196611939 ACCCTAGGGCCTGTTTGTGCTGG - Intergenic
969313778 4:6369669-6369691 GCCTGAGGGCATGGGTGTGCAGG - Intronic
969477358 4:7429161-7429183 GCCCTAGGCAGGGGGTGTGCCGG - Intronic
970370321 4:15399295-15399317 TTCCTAGTGGGTGGGTGTGTTGG + Intronic
974402942 4:61427587-61427609 GCCCCAGGGCGTGGGGGTTCAGG - Intronic
975384256 4:73737246-73737268 TTCCTATGGCGTGGGTGGGAGGG + Intergenic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
982126261 4:152186269-152186291 TCCAGAGGGCCTGGGTGTCCTGG - Intergenic
985292977 4:188405398-188405420 TCCGTAGGGAGTGGGTGTATTGG + Intergenic
985292991 4:188405481-188405503 TCCGTAGGGAGTGGGTGTATTGG + Intergenic
985752394 5:1688060-1688082 CCCTGAGGACGTGGGTGTGCAGG - Intergenic
988995714 5:36713173-36713195 TCCTGAGGGCGGGGGTGTGCAGG + Intergenic
991489157 5:67166098-67166120 TCACTAGGCCCTGGGTGTCCCGG - Exonic
992473768 5:77082846-77082868 ACCCTTGGGCCTGGGTGTGGTGG + Intronic
992838043 5:80659409-80659431 TACCTAGGGCTGGGGAGTGCTGG - Intronic
994117399 5:96076079-96076101 GACCTAGGGCGTGGTTGTCCAGG - Intergenic
997693516 5:135843899-135843921 GACCCAGGGCCTGGGTGTGCAGG - Intronic
999654261 5:153797137-153797159 TCTCTAGGGCGTGGGGGTAATGG - Intronic
999868398 5:155726905-155726927 TCCCTAGGCAATGGGTGGGCGGG - Intergenic
1002581551 5:180212047-180212069 TACCTAGGGCCTATGTGTGCCGG + Intergenic
1003957109 6:11174302-11174324 CTCCTAGGGCGTGGATGTGTAGG - Intergenic
1005612083 6:27535985-27536007 TCCCTGGGGTGTGGGGGTGAAGG - Intergenic
1006814406 6:36840377-36840399 TCCCAGGGGCTTGGGTGTGGAGG + Intergenic
1007470914 6:42089641-42089663 TCCCTGAGGCGTGGGTGGACAGG + Intergenic
1008639805 6:53450171-53450193 TCTCTGGGGTGTGGGTGTGGTGG + Intergenic
1019339703 7:503232-503254 TCCCCAGGGCCTGGGAGGGCAGG - Intronic
1019618712 7:1979128-1979150 ACCCCAGGGAGTGGGTGTGACGG + Intronic
1022375339 7:29806793-29806815 TCCTGAGGGCGTGGGAGGGCCGG + Intronic
1027844597 7:83356644-83356666 TCCTTTGGGCGTGGGTTTGAAGG - Intergenic
1034965996 7:155391411-155391433 CCCCGAGGGAGTGGGTTTGCAGG - Intronic
1035327834 7:158076307-158076329 TCCCTGGGGAGTGGGTGTGTGGG + Intronic
1039079532 8:33721710-33721732 TCTCTAGGCCGTGAGTGAGCCGG - Intergenic
1039079545 8:33721768-33721790 TCTCTAGGCCGTGAGTGAGCCGG - Intergenic
1041194596 8:55388078-55388100 TCACTAGGGAGGGGGTCTGCTGG + Intronic
1041794459 8:61731672-61731694 TCCCTAGCCCGTGGGGGTACAGG + Intergenic
1041943574 8:63416776-63416798 TCCCAGGTGCGTGGATGTGCTGG + Intergenic
1044991482 8:97800235-97800257 TCCCTAGGGACTGAGAGTGCGGG + Intronic
1049385211 8:142339711-142339733 TCCCTCGGGAGTGGTTGTCCAGG - Intronic
1049721400 8:144117192-144117214 TCCCAAGAGCATGGGTGCGCAGG + Exonic
1049792299 8:144477812-144477834 TCCTTGGGGCGTGGGTGGGACGG - Intergenic
1052374135 9:27698627-27698649 TCCATAGGGCCTGGGGGTGGGGG + Intergenic
1056731051 9:89167088-89167110 CCCCCAGGGCAGGGGTGTGCTGG - Intronic
1057995889 9:99821579-99821601 TCGCCAGGGCGTGCGTCTGCGGG - Intergenic
1058055222 9:100442238-100442260 TCCCTAGGACGTGGGTACTCAGG - Exonic
1061918461 9:133769384-133769406 TCCCCAGGGCGTGGGGGGACCGG - Intronic
1062000339 9:134212744-134212766 TCCCCAGGGCCTGGCTGAGCCGG - Intergenic
1062655823 9:137604453-137604475 TCACCACGGAGTGGGTGTGCGGG - Intergenic
1062688003 9:137826139-137826161 TCCATAGGGGGTGGGTGGGTGGG + Intronic
1203744583 Un_GL000218v1:34878-34900 TCCCTAGGGTCTGGGTGGCCTGG + Intergenic
1188225507 X:27592366-27592388 TCCCCAGGAGGTAGGTGTGCAGG + Intronic
1189454580 X:41174346-41174368 TCCATGGGGGGTGGGGGTGCAGG - Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1194922096 X:99779194-99779216 CTGCTAGGGGGTGGGTGTGCAGG + Intergenic
1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG + Intronic