ID: 976456748

View in Genome Browser
Species Human (GRCh38)
Location 4:85256699-85256721
Sequence TTTTTTCCACAGATTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976456743_976456748 18 Left 976456743 4:85256658-85256680 CCAACCTTTTTGGCACCAGAGAC 0: 72
1: 1078
2: 1756
3: 1387
4: 967
Right 976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG No data
976456741_976456748 20 Left 976456741 4:85256656-85256678 CCCCAACCTTTTTGGCACCAGAG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
Right 976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG No data
976456742_976456748 19 Left 976456742 4:85256657-85256679 CCCAACCTTTTTGGCACCAGAGA 0: 78
1: 1103
2: 1667
3: 1354
4: 955
Right 976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG No data
976456744_976456748 14 Left 976456744 4:85256662-85256684 CCTTTTTGGCACCAGAGACCAGT 0: 39
1: 472
2: 900
3: 1308
4: 1244
Right 976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG No data
976456745_976456748 3 Left 976456745 4:85256673-85256695 CCAGAGACCAGTTATATAGAAGA No data
Right 976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG No data
976456746_976456748 -4 Left 976456746 4:85256680-85256702 CCAGTTATATAGAAGACAATTTT No data
Right 976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976456748 Original CRISPR TTTTTTCCACAGATTGAAGA GGG Intergenic
No off target data available for this crispr