ID: 976463688

View in Genome Browser
Species Human (GRCh38)
Location 4:85343428-85343450
Sequence AAGCTGATTTTTAGGACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976463688_976463693 25 Left 976463688 4:85343428-85343450 CCACCTGTCCTAAAAATCAGCTT No data
Right 976463693 4:85343476-85343498 CATGTCTGAAATATGTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976463688 Original CRISPR AAGCTGATTTTTAGGACAGG TGG (reversed) Intergenic
No off target data available for this crispr