ID: 976466855

View in Genome Browser
Species Human (GRCh38)
Location 4:85379943-85379965
Sequence CTCAAGTTCTTAAAGTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976466854_976466855 2 Left 976466854 4:85379918-85379940 CCTTTCAGGTGTCTTATAGACTC No data
Right 976466855 4:85379943-85379965 CTCAAGTTCTTAAAGTGTACAGG No data
976466852_976466855 16 Left 976466852 4:85379904-85379926 CCTAAATTTTGATGCCTTTCAGG No data
Right 976466855 4:85379943-85379965 CTCAAGTTCTTAAAGTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976466855 Original CRISPR CTCAAGTTCTTAAAGTGTAC AGG Intergenic
No off target data available for this crispr